ID: 1185585056

View in Genome Browser
Species Human (GRCh38)
Location X:1236545-1236567
Sequence ACGGGCCATGATGACGATGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2380
Summary {0: 363, 1: 891, 2: 815, 3: 196, 4: 115}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185585048_1185585056 20 Left 1185585048 X:1236502-1236524 CCTCTGGGCCCGTCTGGGAGGTG No data
Right 1185585056 X:1236545-1236567 ACGGGCCATGATGACGATGGCGG 0: 363
1: 891
2: 815
3: 196
4: 115
1185585050_1185585056 11 Left 1185585050 X:1236511-1236533 CCGTCTGGGAGGTGTGCCCAACA 0: 409
1: 1169
2: 547
3: 86
4: 136
Right 1185585056 X:1236545-1236567 ACGGGCCATGATGACGATGGCGG 0: 363
1: 891
2: 815
3: 196
4: 115
1185585052_1185585056 -5 Left 1185585052 X:1236527-1236549 CCCAACAGCTCATTGAGAACGGG 0: 1295
1: 586
2: 145
3: 41
4: 71
Right 1185585056 X:1236545-1236567 ACGGGCCATGATGACGATGGCGG 0: 363
1: 891
2: 815
3: 196
4: 115
1185585041_1185585056 29 Left 1185585041 X:1236493-1236515 CCCCTCTGCCCTCTGGGCCCGTC No data
Right 1185585056 X:1236545-1236567 ACGGGCCATGATGACGATGGCGG 0: 363
1: 891
2: 815
3: 196
4: 115
1185585042_1185585056 28 Left 1185585042 X:1236494-1236516 CCCTCTGCCCTCTGGGCCCGTCT No data
Right 1185585056 X:1236545-1236567 ACGGGCCATGATGACGATGGCGG 0: 363
1: 891
2: 815
3: 196
4: 115
1185585043_1185585056 27 Left 1185585043 X:1236495-1236517 CCTCTGCCCTCTGGGCCCGTCTG No data
Right 1185585056 X:1236545-1236567 ACGGGCCATGATGACGATGGCGG 0: 363
1: 891
2: 815
3: 196
4: 115
1185585047_1185585056 21 Left 1185585047 X:1236501-1236523 CCCTCTGGGCCCGTCTGGGAGGT No data
Right 1185585056 X:1236545-1236567 ACGGGCCATGATGACGATGGCGG 0: 363
1: 891
2: 815
3: 196
4: 115
1185585049_1185585056 12 Left 1185585049 X:1236510-1236532 CCCGTCTGGGAGGTGTGCCCAAC 0: 415
1: 1252
2: 539
3: 139
4: 141
Right 1185585056 X:1236545-1236567 ACGGGCCATGATGACGATGGCGG 0: 363
1: 891
2: 815
3: 196
4: 115
1185585054_1185585056 -6 Left 1185585054 X:1236528-1236550 CCAACAGCTCATTGAGAACGGGC 0: 1290
1: 604
2: 139
3: 40
4: 84
Right 1185585056 X:1236545-1236567 ACGGGCCATGATGACGATGGCGG 0: 363
1: 891
2: 815
3: 196
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185585056 Original CRISPR ACGGGCCATGATGACGATGG CGG Intergenic
Too many off-targets to display for this crispr