ID: 1185585058

View in Genome Browser
Species Human (GRCh38)
Location X:1236553-1236575
Sequence TGATGACGATGGCGGTTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1990
Summary {0: 67, 1: 782, 2: 384, 3: 414, 4: 343}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185585049_1185585058 20 Left 1185585049 X:1236510-1236532 CCCGTCTGGGAGGTGTGCCCAAC 0: 415
1: 1252
2: 539
3: 139
4: 141
Right 1185585058 X:1236553-1236575 TGATGACGATGGCGGTTTTGTGG 0: 67
1: 782
2: 384
3: 414
4: 343
1185585054_1185585058 2 Left 1185585054 X:1236528-1236550 CCAACAGCTCATTGAGAACGGGC 0: 1290
1: 604
2: 139
3: 40
4: 84
Right 1185585058 X:1236553-1236575 TGATGACGATGGCGGTTTTGTGG 0: 67
1: 782
2: 384
3: 414
4: 343
1185585047_1185585058 29 Left 1185585047 X:1236501-1236523 CCCTCTGGGCCCGTCTGGGAGGT No data
Right 1185585058 X:1236553-1236575 TGATGACGATGGCGGTTTTGTGG 0: 67
1: 782
2: 384
3: 414
4: 343
1185585050_1185585058 19 Left 1185585050 X:1236511-1236533 CCGTCTGGGAGGTGTGCCCAACA 0: 409
1: 1169
2: 547
3: 86
4: 136
Right 1185585058 X:1236553-1236575 TGATGACGATGGCGGTTTTGTGG 0: 67
1: 782
2: 384
3: 414
4: 343
1185585048_1185585058 28 Left 1185585048 X:1236502-1236524 CCTCTGGGCCCGTCTGGGAGGTG No data
Right 1185585058 X:1236553-1236575 TGATGACGATGGCGGTTTTGTGG 0: 67
1: 782
2: 384
3: 414
4: 343
1185585052_1185585058 3 Left 1185585052 X:1236527-1236549 CCCAACAGCTCATTGAGAACGGG 0: 1295
1: 586
2: 145
3: 41
4: 71
Right 1185585058 X:1236553-1236575 TGATGACGATGGCGGTTTTGTGG 0: 67
1: 782
2: 384
3: 414
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185585058 Original CRISPR TGATGACGATGGCGGTTTTG TGG Intergenic
900563577 1:3320878-3320900 TGGGGAGGATGGTGGTTTTGAGG + Intronic
901030499 1:6304861-6304883 TGATGACAATGGCAGTTTTGTGG - Intronic
901223883 1:7600949-7600971 TGATGACAATGGTGGTTTTGTGG - Intronic
901271206 1:7953408-7953430 TGATGACAATGGCGGTTTTGTGG + Intergenic
901341947 1:8502615-8502637 TGATGACAATGGCGGTTTTGTGG + Intronic
901386433 1:8912300-8912322 TGATGACAATGGCGGTTTTGTGG + Intergenic
901555656 1:10029277-10029299 TGATGACACTGGCGGTTTTGTGG + Intergenic
901726905 1:11249885-11249907 TGATGACAGTGGCGGTTTTGTGG - Intronic
901855902 1:12043702-12043724 TGATGACAATGGCGGTTTTGTGG + Intergenic
901970418 1:12903186-12903208 TGATGACAATGGCAGTTTTGTGG + Intronic
902014747 1:13298583-13298605 TGATGACAATGGCAGTTTTGTGG - Intergenic
902019142 1:13329604-13329626 TGATGACAATGGCGGTTTTGTGG + Intergenic
902027445 1:13394743-13394765 TGATGACAATGGCGGTTTTGTGG - Intergenic
903081864 1:20816770-20816792 TGATGACAATGGCGGTTTTGTGG + Intronic
903100492 1:21024418-21024440 GGATGACAATGGCGGCTTTGTGG + Intronic
903103658 1:21053997-21054019 CGATGACAATGGCGGTTTTGTGG + Intronic
903148639 1:21389282-21389304 GGATGACAATGGCGGCTTTGTGG + Intergenic
903162895 1:21502502-21502524 TGATGACGATGGTGGTTTTGTGG - Intergenic
903426582 1:23257956-23257978 TGATGGCAATGGCGGTTTTGTGG + Intergenic
903458477 1:23504498-23504520 TGATGACAATGGCGGTTTTGTGG + Intergenic
903476946 1:23626110-23626132 TGATGATGATGGTGATGTTGGGG + Intronic
903485973 1:23689280-23689302 GGATGACAATGGCGGTTTTGTGG + Intergenic
903508286 1:23853591-23853613 TGATGACAATGGCGGTTTTGTGG + Intronic
903519518 1:23936013-23936035 TGATGACAATGGCGGTTTTGTGG + Intergenic
903524995 1:23987002-23987024 TGATGACGATGGCGGTTTTGTGG - Intergenic
903525803 1:23993186-23993208 GGATGACAATGGCGGCTTTGTGG - Intergenic
903531136 1:24031893-24031915 GGATGACAATGGCGGCTTTGTGG - Intergenic
903634404 1:24800593-24800615 GGATGACAATGGCGGCTTTGTGG + Intronic
903637438 1:24832745-24832767 TGATGACAATGGCGGTTTTGTGG - Intronic
903748644 1:25604474-25604496 TGATGACAATGGCGGTTTTGTGG + Intergenic
903895067 1:26597025-26597047 TGATGACAATGGCGGTTTTGTGG + Intergenic
903921320 1:26803347-26803369 TGATGACGATGGCGGTTTTCTGG - Intergenic
903924099 1:26819191-26819213 GGATGACAATGGCGGCTTTGTGG + Intergenic
903962469 1:27065072-27065094 TGATGACAATGGCGGTTTTGTGG + Intergenic
903985009 1:27220688-27220710 TGATGACGATGGCGGTTTTGTGG + Intergenic
903993188 1:27288817-27288839 GGATGACAATGGCGGTTTTGTGG - Intronic
904074408 1:27829302-27829324 TGATGACAATGGCGGTTTTGTGG + Intergenic
904078072 1:27854611-27854633 GGATGACAATGGCGGCTTTGTGG + Intergenic
904092624 1:27955953-27955975 TGATGAACATGGCGCTTATGGGG - Exonic
904406645 1:30294869-30294891 TGATGACTTTGACAGTTTTGAGG - Intergenic
904532321 1:31177190-31177212 TGATGGCAATGGCGGTTTTGTGG + Intergenic
904784307 1:32973938-32973960 TGGTGACAATGGCGGTTTTGTGG - Intergenic
904795462 1:33052994-33053016 GGATGACAATGGCGGCTTTGTGG + Intronic
904857230 1:33509112-33509134 TGATGACAATGGCGGTTTTGTGG - Intergenic
905041903 1:34967544-34967566 TGATGACAATGGCGGTTTTGTGG - Intergenic
905192073 1:36243664-36243686 TGATGACAATGGCGGTTTTGTGG - Intronic
905316031 1:37081654-37081676 TGATGACAATGGCGGTTGTGTGG + Intergenic
905427716 1:37897261-37897283 TGATGACAATGGCGGTTTTGTGG + Intronic
905527180 1:38647840-38647862 TGATGACAATGGCGGTTTTGTGG + Intergenic
905598988 1:39234256-39234278 GGATGACAATGGCGGCTTTGTGG - Intronic
905699448 1:40000152-40000174 GGATGACAATGGCGGCTTTGTGG + Intergenic
906036153 1:42751096-42751118 TGATGACGATGGCGGTTTTGTGG + Intronic
906136337 1:43502488-43502510 GGATGACAATGGCGGTTTTGTGG + Intergenic
906330029 1:44876723-44876745 TGATGACAATGGCGGTTTTGTGG + Intronic
906353337 1:45081855-45081877 GGATGACAATGGCGGCTTTGTGG + Intronic
906367580 1:45223379-45223401 TGATGACAATGGCGGTTTTGTGG + Intronic
906400053 1:45497908-45497930 GGATGACAATGGCGGCTTTGTGG + Intronic
906427551 1:45725616-45725638 TGATGACAATGGCGGTTTTGTGG + Intronic
906429076 1:45740289-45740311 TGATGACAATGGCGGTTTTGTGG - Intronic
906487425 1:46242462-46242484 GGATGACAATGGCGGCTTTGTGG + Intergenic
906742206 1:48193156-48193178 GGATGACAATGGCGGCTTTGTGG + Intergenic
906761327 1:48382172-48382194 TGATGACAATGGCGGTTTTGTGG - Intronic
906770718 1:48479765-48479787 GGACGACAATGGCGGTTTTGTGG + Intergenic
906956955 1:50382090-50382112 TGATGACAATGGCGGTTTTGTGG + Intergenic
907089470 1:51711173-51711195 GGATGACGATGGCGGCTTTGTGG - Intronic
907140727 1:52182277-52182299 TGATGACAGTGGCGGTTTTGTGG + Intronic
907216513 1:52869711-52869733 TGATGACAATGGCGGTTTTGTGG - Intronic
907283377 1:53365178-53365200 TGATGACCTTGACAGTTTTGAGG - Intergenic
907402653 1:54233877-54233899 GGATGACAATGGCGGCTTTGTGG + Intronic
907453364 1:54561569-54561591 GGATGACAATGGCGGCTTTGTGG - Intronic
908370691 1:63474423-63474445 TGATGACAATGGCGGTTTTGTGG + Intronic
908446369 1:64201798-64201820 TGATGACAATGGCGGTTTTGTGG + Intergenic
908468263 1:64416049-64416071 GGATGACAATGGCGGTTTTGTGG + Intergenic
909478761 1:76111905-76111927 TGATGACAACGGCGGTTTTGTGG - Intronic
909640772 1:77869409-77869431 TGATGACAATGGCGGTTTTGTGG - Intronic
910344175 1:86216845-86216867 GGATGACAATGGCGGCTTTGTGG + Intergenic
910406740 1:86899252-86899274 TGATGACAATGGTGGTTTTGTGG - Intronic
910673663 1:89797670-89797692 TGATGACAATGGCGGTTTTGTGG - Intronic
910777470 1:90891637-90891659 TGATGACAATGGCGGTTTTGTGG - Intergenic
911215364 1:95187426-95187448 TGGTGACCTTGACGGTTTTGAGG + Intronic
911325757 1:96469562-96469584 TGATGACAATGGCGGTTTTGTGG - Intergenic
911351549 1:96762196-96762218 TGATGACAATGGCGGTTTTGTGG - Intronic
911431433 1:97792838-97792860 TGATGACCTTGACAGTTTTGAGG - Intronic
911486437 1:98512250-98512272 TGAGGACAGTGGCGGTTTTGTGG - Intergenic
911598672 1:99823939-99823961 TGATGACGACGGCGGTTTTGTGG + Intergenic
911601977 1:99856906-99856928 TGATGACGACGGCGGTTTTGTGG - Intronic
912116420 1:106412875-106412897 TGATGACAATGGTGGTTTTGTGG + Intergenic
912266091 1:108159932-108159954 TGATGACAATGGCGGTTTTGTGG - Intronic
912298014 1:108488812-108488834 GGATGACAATGGCGGCTTTGTGG - Intergenic
912317131 1:108676227-108676249 TGATGACAATGGCGGTTTTGTGG + Intergenic
912371400 1:109177072-109177094 TGATGACAATGGCGGTTTTGTGG - Intronic
912629399 1:111233719-111233741 TGATGACAATGGCGGTTTTGTGG + Intronic
912660919 1:111529835-111529857 TGATGACAATGGCGGTTTTGTGG - Intronic
912668831 1:111607478-111607500 TGATGACAATGGCGGTTTTGTGG - Intronic
912690321 1:111800069-111800091 GGATGATAATGGCGGCTTTGTGG + Intronic
912752210 1:112294553-112294575 TGATGACAATGGCGGTTTTGTGG + Intergenic
912790088 1:112640749-112640771 GGATGACAATGGCGGCTTTGTGG + Intronic
912808404 1:112774488-112774510 GGATGACAATGGCGGCTTTGTGG + Intergenic
912825050 1:112898090-112898112 GGATGACAATGGCAGCTTTGTGG - Intergenic
912845387 1:113070660-113070682 GGATGACAATGGCGGCTTTGTGG + Intergenic
912990329 1:114480008-114480030 TGATGATGATGGCGGTTTTGTGG + Intronic
913021052 1:114790428-114790450 GGATGACAATGGCGGCTTTGTGG - Intergenic
913305725 1:117429269-117429291 GGATGACAATGGCGGCTTTGTGG - Intronic
913326555 1:117633185-117633207 TGATGATGATGCCGGCTTTGGGG + Intergenic
913994314 1:143639124-143639146 TGATGACAATGGCGGTTTTGTGG + Intergenic
914002452 1:143703666-143703688 TGATGACAATGGCCGTTTTGTGG + Intergenic
914231092 1:145764949-145764971 TGATGACGATGGCGGTTTTGTGG + Intronic
914231238 1:145766461-145766483 TGATGACAATGGCGGTTTTGTGG - Intronic
914467951 1:147949227-147949249 TGATGACAATGGCGGTTTTGTGG - Intronic
914774956 1:150728415-150728437 GGATGACAATGGCGGCTTTGTGG - Intergenic
914780724 1:150782053-150782075 GGATGACAATGGCGGCTTTGTGG + Intergenic
914888363 1:151601250-151601272 TGATGACAATGGCAGTTTTGTGG + Intergenic
914893693 1:151651068-151651090 GGATGACAATGGCGGCTTTGTGG - Intronic
914959719 1:152195940-152195962 TGATGACGATGGCGGTTTTGTGG - Intergenic
914965703 1:152256052-152256074 TGATGACAATGGCTGTTTTGTGG - Intergenic
914987267 1:152471871-152471893 TGATGACAATGGCAGTTTTGTGG - Intergenic
915114004 1:153583424-153583446 TGATGACAATGGCGGTTTTGTGG + Intergenic
915208477 1:154287939-154287961 TGATGATAATGGCGGTTTTGTGG + Intergenic
915411096 1:155701206-155701228 GGATGACAATGGCGGCTTTGTGG + Intronic
915502485 1:156328384-156328406 TGATGACAATGGCGGTTTTGTGG + Intronic
915539871 1:156558650-156558672 TGATGACAATGGCGGTTTTGTGG + Intronic
916037456 1:160933682-160933704 TGATGATGATGACGGTTTTGTGG + Intergenic
916037826 1:160936655-160936677 TGATGACGATGGCAGTTTTGTGG - Intergenic
916087358 1:161281308-161281330 TGATGACAATGGCGGTTTTGTGG - Intronic
916105098 1:161423827-161423849 TGATGACAATGGCGGTTTTGTGG + Intergenic
916131578 1:161616425-161616447 TGATGACGATGGCGGTTTTGTGG - Intronic
916223500 1:162466344-162466366 TGATGACAATGGCGGTTTTGTGG + Intergenic
916256937 1:162798416-162798438 TGATGACCTTGACAGTTTTGAGG + Intronic
916478107 1:165189191-165189213 TGATGACCTTGACAGTTTTGAGG + Intergenic
917006325 1:170419407-170419429 TGATGACAATGGTGGTTTTGTGG + Intergenic
917206110 1:172572227-172572249 TGATGACAATGGTGGTTTTGTGG + Intronic
917304784 1:173613797-173613819 TGATGACGATGGCGGTTTTGTGG + Intronic
917375513 1:174348925-174348947 GGATGACAATGGCGGCTTTGTGG - Intronic
917553414 1:176058295-176058317 TGATGACAATGGCGGTTTTGTGG + Intronic
917582710 1:176395739-176395761 TGATGACAATGGCGGTTTTGTGG - Intergenic
917737336 1:177932926-177932948 GGATGAGGAGGGGGGTTTTGGGG - Intronic
917848179 1:179040199-179040221 TGATGACAGTGGCGGTTTTGTGG - Intronic
917860178 1:179136237-179136259 TGATGACAATGGCGGTTTTGTGG + Intronic
917888999 1:179418456-179418478 TGATGACAATGGCGGTTTTGTGG - Intronic
918101934 1:181383847-181383869 TGATGATGTAGGAGGTTTTGTGG - Intergenic
918166590 1:181954999-181955021 TGATGACGATGGCGGTTTTGTGG + Intergenic
918221346 1:182439724-182439746 TGATGACAATGGCGGTTTTGTGG - Intergenic
918228482 1:182509153-182509175 GGATGACAATGGCGGCTTTGTGG - Intronic
919080306 1:192857912-192857934 TGATGACAATGGCGGTTTTGTGG + Intergenic
919129665 1:193437359-193437381 TGATGACGATGGCAGTTTTGTGG - Intergenic
919423992 1:197406103-197406125 TGATGACAATGGCGGTTTTGTGG + Intronic
919625166 1:199904311-199904333 TGATGACAATGGCAGTTTTGTGG - Intergenic
919925746 1:202191289-202191311 GGATGACAATGGCGGCTATGTGG - Intergenic
919959345 1:202451637-202451659 TGATGACAATGGCGGTTTTGTGG - Intronic
919994846 1:202739941-202739963 GGATGACAATGGCGGTTTTGTGG - Intronic
920152113 1:203919032-203919054 TGATGACAATGGCGGTTTTGTGG - Intergenic
920451767 1:206064804-206064826 GGATGACAATGGCGGCTTTGTGG + Intronic
920749367 1:208659403-208659425 GGATGACAATGGCGGCTTTGTGG - Intergenic
921044138 1:211461013-211461035 GGATGACAATGGCGGCTTTGTGG + Intergenic
921139966 1:212298286-212298308 TGATGACAATGGCGGTTTTGTGG - Intronic
921142294 1:212320412-212320434 TGATGACAATGGCGGTTTTGTGG - Intronic
921198457 1:212780031-212780053 TGATGACAATGGCGGTTTTGTGG + Intronic
921237666 1:213150780-213150802 GGATGACAATGGCGGCTTTGTGG - Intronic
921413956 1:214869067-214869089 TGATGACAATGGCGGCTTTGTGG - Intergenic
921638257 1:217523640-217523662 TGATGACAATGGCGGTTTTGTGG - Intronic
921802370 1:219416298-219416320 TGAGGACCATGACAGTTTTGAGG + Intergenic
921814283 1:219546396-219546418 TGATGACAATGGCCGTTTTGTGG + Intergenic
921902565 1:220466150-220466172 GGATGACGATGGCGGTTTTGTGG - Intergenic
921946985 1:220892833-220892855 TGAGGAGGATGGCACTTTTGTGG - Intergenic
922102929 1:222488896-222488918 GGATGACAATGGCGGTTTTGTGG + Intergenic
922235967 1:223722960-223722982 TGATGACCTTGACAGTTTTGGGG + Intronic
922503689 1:226114766-226114788 TGATGACAATGGCAGTTTTGTGG - Intergenic
922633022 1:227133491-227133513 TGATGACAATGGCGGTTTTGTGG + Intronic
922692950 1:227710469-227710491 TGATGACAATGGCGGTTTTGTGG - Intergenic
922992978 1:229931783-229931805 TGATGACGATGGCGGTTTTGTGG - Intergenic
923021657 1:230168985-230169007 TTATGACCTTGACGGTTTTGAGG + Intronic
923094780 1:230766507-230766529 TGATGACCTTGACGGTTTTGAGG - Intronic
923137179 1:231128920-231128942 TGATGACAATGGCGGTTTTGTGG + Intergenic
923268208 1:232332614-232332636 TGATGACAATGGCGGTTTTGTGG + Intergenic
923468121 1:234267345-234267367 TGATGACAATGGCGGTTTTGTGG - Intronic
923590045 1:235309701-235309723 TGATGACAATGGCGGTTTTGTGG + Intronic
923711131 1:236387526-236387548 GGATGACAATGGCGGCTTTGTGG + Intronic
923792878 1:237127251-237127273 GGATGACAATGGCGGCTTTGTGG - Intronic
923840791 1:237669343-237669365 TGATGACAATGGCGGTTTTGTGG - Intronic
924178330 1:241415766-241415788 GGATGACAATGGCGGCTTTGTGG + Intergenic
924692363 1:246363448-246363470 TGATGACAATGGCGGTTTTGTGG + Intronic
924734146 1:246739400-246739422 TGATGACCTTGATGGTTTTGAGG - Intronic
924766171 1:247032817-247032839 TGATGACAATGGCGATTTTGTGG + Intergenic
924788443 1:247220774-247220796 TGATGACAATGGCGGTTTTGTGG + Intergenic
924794480 1:247283282-247283304 TGATGACCTTGATGGTTTTGAGG + Intergenic
924925681 1:248677089-248677111 GGATGACAATGGCGGTTTTGTGG + Intergenic
924954193 1:248911584-248911606 GGATGACAATGGCGGCTTTGTGG - Intronic
1062790101 10:298229-298251 TGCTGACCTTGACGGTTTTGAGG + Intronic
1062992003 10:1828125-1828147 TGGTGACAATGGCAGTGTTGGGG + Intergenic
1063084721 10:2806431-2806453 TGATGACAATGGCGGTTTTGTGG - Intergenic
1063438801 10:6055670-6055692 GGATGACAATGGCGGCTTTGTGG - Intronic
1063459497 10:6206419-6206441 TGACGACAATGGCGGTTTTGTGG - Intronic
1063497929 10:6527367-6527389 TGATGATGATGTTGGTTATGAGG + Intronic
1063547120 10:6992074-6992096 TGATGACAATGGCGGTTTTGTGG + Intergenic
1063745040 10:8869446-8869468 TGATGACAATGGCGGTTTTGTGG + Intergenic
1064108163 10:12518954-12518976 TGATGACAATGGCGGTTTTGTGG - Intronic
1064108970 10:12522664-12522686 TGATGACAATGGCGGTTTTGTGG - Intronic
1064325319 10:14345421-14345443 TGATGACCTTGGCAGCTTTGAGG - Intronic
1064498071 10:15936953-15936975 TGATGACTTTGACAGTTTTGAGG + Intergenic
1064663395 10:17628816-17628838 GGATGACAATGGCGGCTTTGTGG - Intergenic
1065012320 10:21430727-21430749 GGATGACAATGGCGGCTTTGTGG + Intergenic
1065336483 10:24657578-24657600 GGATGACAATGGCTGCTTTGTGG + Intronic
1065594146 10:27296028-27296050 GGATGACAATGGCGGCTTTGTGG - Intergenic
1065724325 10:28655175-28655197 TGATGACGATGGCGGTTTTGTGG + Intergenic
1065840604 10:29697344-29697366 TGATGACGATGGCGGTTTTCTGG + Intronic
1066085871 10:31971142-31971164 TGATGACAATGGCGGTTTTGTGG + Intergenic
1066434776 10:35387332-35387354 TGGTGATGATGGTGGTTCTGAGG + Intronic
1066437308 10:35406696-35406718 TGATGACAGTGGCAGTTTTGTGG - Intronic
1066723399 10:38364111-38364133 TGATGACCTTGACAGTTTTGAGG + Intergenic
1066952990 10:42138528-42138550 TGATGACAATGGCGGTTTTGTGG + Intergenic
1067026629 10:42847863-42847885 TGATGACAATGGCGGTTTTGTGG + Intergenic
1067034257 10:42900804-42900826 TGATGATGATGGTGGTTTTGTGG + Intergenic
1067119836 10:43464836-43464858 TGATGACGATGGCGGTTTTGTGG - Intronic
1067325368 10:45260523-45260545 TGATGACAATGGCGGTTTTGTGG + Intergenic
1067331912 10:45330547-45330569 TGATGACAATGGCGGTTTTGTGG - Intergenic
1067339912 10:45392235-45392257 TGATGACAATGGTGGTTTTGTGG + Intronic
1067354672 10:45512752-45512774 GGACGACAATGGCGGTTTTGTGG + Intronic
1068005847 10:51392598-51392620 TGATGACAATGGCGGTTTTGTGG - Intronic
1068668135 10:59697260-59697282 TGATGACAATGGCGGTTTTGTGG + Intronic
1068751732 10:60601547-60601569 TGATGACCTTGACGGTCTTGAGG - Intronic
1068853467 10:61771480-61771502 TGATGATTTTGGCAGTTTTGAGG - Intergenic
1068969952 10:62948620-62948642 TGATGACAATGGCGGTTTTGTGG + Intergenic
1069044472 10:63727952-63727974 TGATGATGATGCTGGCTTTGTGG - Intergenic
1069052528 10:63811241-63811263 CGATGACAATGGCCGTTATGTGG - Intergenic
1069365884 10:67692267-67692289 TGATGACAATGGCGGTTTTGTGG + Intronic
1069645243 10:69992544-69992566 TGATGACAATGGCGGTTTTGTGG - Intergenic
1069698867 10:70407581-70407603 TGATGACAACGGCGGTTTTGTGG - Intronic
1069733082 10:70631526-70631548 TGATGACAATGGCGGTTTTGTGG + Intergenic
1069740895 10:70686752-70686774 GGATGACAATGGCGGCTTTGTGG - Intronic
1069928732 10:71869125-71869147 TGATGACAATGGCGGTTTTGTGG - Intergenic
1069929931 10:71875613-71875635 TGATGACAATGGCGGTTTTGTGG - Intergenic
1070135590 10:73690135-73690157 TGATGACAATGGCGGTTTTGTGG + Intronic
1070317808 10:75332942-75332964 GGATGACAATGGCGGCTTTGTGG - Intergenic
1070683953 10:78468395-78468417 TGATTACTATGGCGGTTTTGTGG - Intergenic
1070966844 10:80535091-80535113 TGATGACAATGGCGGTTTTGTGG + Intergenic
1071616753 10:87081474-87081496 TGATGACAATGGTGGTTTTGTGG + Intronic
1071680175 10:87697125-87697147 TGATGACCTTGACAGTTTTGAGG + Intronic
1072013242 10:91322955-91322977 TGATGACAATGGCGGTTTTGTGG - Intergenic
1072117385 10:92376960-92376982 GGATGACAATGGCGGCTTTGTGG + Intergenic
1072149466 10:92674197-92674219 GGATGACAATGGCGGCTTTGTGG - Intergenic
1072180656 10:92976201-92976223 TGATGACAGTGGCGATTTTGTGG + Intronic
1072291836 10:93971138-93971160 TGATGACAATGGCGGTTTTGTGG + Intergenic
1072602052 10:96940782-96940804 TGATGACAATGGCAGTTTTGTGG - Intronic
1072648877 10:97277124-97277146 GGATGACAATGGCGGCCTTGTGG + Intronic
1072684164 10:97527914-97527936 TGATGACAATGGCGGTTTTGTGG - Intronic
1072730436 10:97841996-97842018 TGATGGCAATGGCGGTTTTGTGG + Intergenic
1072772546 10:98153140-98153162 TGATGACAATGGCGGTTTTGTGG + Intronic
1072860741 10:99002571-99002593 TGATGATGTTGACAGTTTTGAGG - Intronic
1072949236 10:99837939-99837961 GGATGACAATGGCGGCATTGTGG - Intronic
1072956620 10:99892285-99892307 GGATGACAATGGCGGCTTTGTGG + Intronic
1072980632 10:100094072-100094094 GGATGACAATGGCGGCTTTGTGG + Intergenic
1073000149 10:100278360-100278382 TGATGACGATGGCGGTTTTCTGG + Intronic
1073238347 10:102036403-102036425 TGATGACGATGGCGGTTTTGTGG + Intronic
1073305191 10:102497756-102497778 TTATGATGATGGTTGTTTTGCGG + Intronic
1073386566 10:103130082-103130104 GGATGACAATGGCGGCTTTGTGG + Intronic
1073433880 10:103504356-103504378 TGATGACCTTGACAGTTTTGAGG + Intronic
1073450822 10:103607679-103607701 TGATGACAATGGCGGTTTTGTGG + Intronic
1073594278 10:104784913-104784935 GGATGACAATGGCGGCTTTGTGG - Intronic
1073865682 10:107801060-107801082 TGATGACAATGGCAGTTTTGTGG + Intergenic
1074151871 10:110766792-110766814 TGATGACAATGGCGGTTTTGTGG - Intronic
1074588222 10:114787857-114787879 TGATGACAATGGCAGTTTTGTGG + Intergenic
1075050745 10:119181772-119181794 CGATGACAATGGTGGTTTTGTGG - Intergenic
1075061569 10:119260872-119260894 TGATGACAATGGCGGTTTTGTGG - Intronic
1075128999 10:119722603-119722625 GGATGACAATGGCGGCTTTGTGG + Intergenic
1075136855 10:119794486-119794508 TGATGACAATGGCGGTTTTGTGG - Intronic
1075181332 10:120214932-120214954 TGATGACAATGGCGGTTTTGTGG - Intergenic
1075578782 10:123600373-123600395 TGATGACCTTGACAGTTTTGAGG + Intergenic
1075651398 10:124130043-124130065 TCATGAGGATGGGGGTGTTGAGG + Intergenic
1075842854 10:125518715-125518737 AGATGACAATGGCGGTTTTGTGG + Intergenic
1075933454 10:126319531-126319553 TGATGACCTAGACGGTTTTGGGG - Intronic
1076327138 10:129633459-129633481 TGATGATAATGGCTGTTTTAGGG + Intronic
1076582962 10:131526253-131526275 TGATGACCTTGATGGTTTTGTGG - Intergenic
1076914325 10:133414382-133414404 TGATGACAATGGCGGTTTTGTGG - Intronic
1077397717 11:2332991-2333013 GGATGACAATGGCGGCTTTGTGG + Intergenic
1077577797 11:3397601-3397623 TGATGACAATGGCGGTTTTGTGG + Intergenic
1077668443 11:4137236-4137258 AGATGACAATGGCGGCTTTGTGG - Intronic
1077837066 11:5934743-5934765 AGATGACAATGGAGGCTTTGTGG + Intronic
1078177253 11:8979051-8979073 TGATGACAATGGCGGTTTTGTGG + Intergenic
1079020869 11:16907791-16907813 TGATGACAATGGCGGTTTTGTGG + Intronic
1079039610 11:17050068-17050090 GGATGACAATGGCGGCTTTGTGG - Intergenic
1079174028 11:18121527-18121549 GGATGACAATGGCGCCTTTGTGG + Intronic
1079371756 11:19859607-19859629 TGATGACGATGGCGGTTTTGTGG - Intronic
1079445070 11:20549139-20549161 TGATGACAATGGCGGTTTTGTGG + Intergenic
1079476707 11:20838244-20838266 TTATGACCTTGACGGTTTTGAGG - Intronic
1079990848 11:27245087-27245109 TGATGACCTTGACAGTTTTGAGG - Intergenic
1080098413 11:28431307-28431329 GGATGACAATGGCGGCTTTGTGG + Intergenic
1080620968 11:33986528-33986550 TGATGACAATGGCGGTTTTGTGG + Intergenic
1080820124 11:35797711-35797733 TGATGGTGAGGACGGTTTTGAGG - Intronic
1080860404 11:36145533-36145555 TGATGACAATGGCGGTTTTGTGG + Intronic
1081289322 11:41305431-41305453 GGATGACAATGGCGGCTTTGTGG + Intronic
1081627525 11:44664151-44664173 GGATGACAATGGCGGCTTTGTGG + Intergenic
1081784542 11:45737993-45738015 GGATGACAATGGCGGCTTTGTGG - Intergenic
1081934862 11:46897840-46897862 TGATGACAATGGCGGTTTTGTGG - Intronic
1081950086 11:47037853-47037875 TGATGACAATGGCGGTTTTGTGG - Intronic
1081956598 11:47097834-47097856 GGATGACAATGGCGGCTTTGTGG + Intronic
1082065300 11:47893599-47893621 TGATGACGATGGCGGTTTTGTGG + Intergenic
1082678910 11:56144086-56144108 TGATGACAATGGCGGTTTTGTGG + Intergenic
1082773703 11:57229470-57229492 TGATGACCTTGACGGTTTGGAGG - Intergenic
1082844427 11:57716049-57716071 GGATGACAATGGCGGTTTTGTGG - Intronic
1083030335 11:59585695-59585717 TGATGACAATGGCGGTTTTGTGG + Intronic
1083036761 11:59645247-59645269 TGATGACAATGGCGGTTTTGTGG - Intronic
1083042371 11:59700072-59700094 TGATGACAATGGCGGTTTTGTGG + Intergenic
1083079107 11:60072981-60073003 TGATGACGATGGCAGTTTTGTGG - Intergenic
1083090977 11:60200757-60200779 TGAGGACAATGGCGGTTTTGTGG - Intergenic
1083115163 11:60451925-60451947 GGATGACAATGGCGGCTTTGTGG + Intronic
1083118987 11:60491936-60491958 TGATGACGATGGCGGTTTTGTGG + Intergenic
1083131114 11:60623173-60623195 TGATGACAATGGCGGTTTTGTGG + Intergenic
1083154839 11:60815884-60815906 GGATGACAATGGCGGCTTTGTGG + Intergenic
1083208171 11:61166224-61166246 TGATGACAATGGCGGTTTTGTGG - Intergenic
1083382763 11:62279822-62279844 GGATGACAATGGCGGCCTTGTGG + Intergenic
1083391709 11:62356088-62356110 TGATGACAATGGCGGTTTTGTGG - Intronic
1083645590 11:64171218-64171240 GGATGACAATGGCGGCCTTGTGG - Intergenic
1083832209 11:65239830-65239852 GGATGACAATGGCGGCTTTGTGG + Intergenic
1083865802 11:65451999-65452021 TGATGACGATGGTGGTTTTGTGG + Intergenic
1083917920 11:65762658-65762680 TGATGACAATGGCGGTTTTGTGG - Intergenic
1083991537 11:66249090-66249112 TGATGACCTTGACAGTTTTGAGG + Intergenic
1084042710 11:66551568-66551590 TGTTAACGTTGGCGATTTTGTGG - Exonic
1084049261 11:66588622-66588644 GGATGACAATGGCAGCTTTGTGG + Intergenic
1084140174 11:67222540-67222562 GGATGACAATGGCGGCTTTGTGG - Intronic
1084186887 11:67477897-67477919 TGATGACAATGGCGGTTTTGTGG - Intergenic
1084206508 11:67597944-67597966 TGATGACGATGGCGGTTTTGTGG - Intergenic
1084291754 11:68175273-68175295 TGATAACCATGGCTGTTTTTAGG - Intronic
1084338275 11:68475380-68475402 TGATGACGATGGCGGTTTTGTGG - Intronic
1084388890 11:68861870-68861892 TGATGACGATGGCGGTTTTGTGG + Intergenic
1084624098 11:70295021-70295043 GGATGACAATGGCGGTTTTGTGG - Intronic
1084924502 11:72501980-72502002 GGATGACAATGGCGGCTTTGTGG - Intergenic
1085073870 11:73572403-73572425 TGATGACAATGGCGGTTTTGTGG + Intronic
1085116388 11:73936053-73936075 TGATGACGATGGCGGTTTTCTGG - Intergenic
1085139601 11:74129012-74129034 TGATGACAATGGCGGTTTTGTGG - Intronic
1085292267 11:75409652-75409674 TGATGACAATGGCGGTTTTGTGG - Intronic
1085359822 11:75877316-75877338 TGATGACAATGGCGGTTTTGTGG - Intronic
1085448871 11:76619371-76619393 TGATGACAATGGCGGTTTTGTGG + Intergenic
1085480973 11:76821876-76821898 TGATGACAATGGCAGTTCTGTGG + Intergenic
1085492456 11:76933749-76933771 TGATGACAATGGTGGTTTTGTGG - Intronic
1085512972 11:77097937-77097959 GGATGACAATGGCGGCTTTGTGG - Intronic
1085563358 11:77490656-77490678 GGATGACAATGGCGGTTTTGTGG + Intergenic
1085609512 11:77933921-77933943 TGATGACAATGGCGGTTTTGTGG + Intronic
1085754637 11:79192294-79192316 TGATGACGATGGCGGTTTTCTGG + Intronic
1086017355 11:82182391-82182413 TGATGACAATGGCAGTTTTATGG + Intergenic
1086104587 11:83133708-83133730 TGATGACAATGGCGGTTTTGTGG + Intergenic
1086122236 11:83316073-83316095 TGATGACAATGGCGGTTTTGTGG - Intergenic
1086341570 11:85853189-85853211 TGATGACAATGGCGGTTTTGTGG + Intergenic
1086366453 11:86111653-86111675 GGATGACAATGGCGGTTTTGTGG + Intergenic
1086430641 11:86732674-86732696 TGATGACAATGGTGGTTTTGTGG + Intergenic
1086434800 11:86770643-86770665 TGATGACGACGGCGGTTTTGTGG - Intergenic
1086447161 11:86879973-86879995 TGATGACAATGGCGGTTTTGTGG + Intronic
1086697371 11:89861126-89861148 TGATGACAATGGCGGTTTTGTGG + Intergenic
1086708788 11:89983361-89983383 TGATGACAATGGCGGTTTTGTGG - Intergenic
1086792972 11:91064016-91064038 TGATGACAATGGCAGTTTTGTGG + Intergenic
1086881788 11:92158437-92158459 TGATGACAATGGCGGTTTTGTGG + Intergenic
1087056383 11:93940589-93940611 TGATGACCTTGACAGTTTTGAGG + Intergenic
1087057006 11:93946554-93946576 GGATGACAATGGCGGCTTTGTGG - Intergenic
1087198089 11:95320696-95320718 GGATGACAATGGCGGCTTTGTGG - Intergenic
1087214875 11:95482933-95482955 GGATGACAATGGCGGTTTTGTGG + Intergenic
1087948842 11:104195154-104195176 GGATGACAATGGCGGCTTTGTGG + Intergenic
1088116156 11:106317148-106317170 TGATGACAATGGCGGTTTTGTGG - Intergenic
1088257286 11:107913002-107913024 TGATGACAATGGCGGTTTTGTGG + Intronic
1088596309 11:111443219-111443241 TGATGACCTTGACAGTTTTGAGG - Intronic
1088658815 11:112026781-112026803 TGATGACAATGGCGGTTTTGTGG - Intronic
1088754009 11:112870599-112870621 TGATGATCTTGGCAGTTTTGAGG + Intergenic
1089264675 11:117251081-117251103 TGATGACAATGGCGGTTTTGTGG - Intronic
1089298220 11:117482118-117482140 TGATGGCGATGGTGGTGTTGGGG + Exonic
1089420620 11:118330752-118330774 GGATGACAATGGCGGCTTTGTGG - Intergenic
1089520341 11:119059081-119059103 TGATGACAATGGTGGTTTTGTGG - Intergenic
1089585389 11:119507456-119507478 GGATGACAATGGCGGCTTTGTGG - Intergenic
1090181654 11:124704857-124704879 GGATGACAATCGCGGCTTTGTGG + Intergenic
1090323425 11:125864198-125864220 GGATGACAATGGCGGCTTTGTGG + Intergenic
1090762194 11:129847851-129847873 TGATGACAATGGCGGTTTTGTGG - Intronic
1090785440 11:130044093-130044115 TGATGACAATGGCGGTTTTGTGG - Intergenic
1090790647 11:130090730-130090752 GGATGACAATGGCGGCTTTGTGG - Intronic
1090906795 11:131084110-131084132 TCATGACAATGGCGGTTTTGTGG - Intergenic
1091378883 12:42830-42852 TGATGACAATGGCGGTTTTGTGG + Intergenic
1091586222 12:1818298-1818320 GGATGACAATGGTGGCTTTGTGG + Intronic
1091762228 12:3095337-3095359 GGATGACAATGGCGGTTTTGTGG - Intronic
1091960414 12:4689765-4689787 TGATGACGATGGTGGTTTTGCGG - Exonic
1092185380 12:6475272-6475294 TTATGACGATGGCGGTTTTGTGG - Intergenic
1092295862 12:7199671-7199693 TGATGACAATGGCGGTTTTGTGG - Intronic
1092331205 12:7589644-7589666 TGATGACAATGGTGGTTTTGTGG - Intergenic
1092402053 12:8184879-8184901 TGATGACAATGGCGGTTTTGTGG + Intronic
1092454031 12:8626297-8626319 TGATGACAATGGCGGTTTTGTGG + Intergenic
1092591277 12:9953737-9953759 GGATGACAATGGCGGCTTTGTGG + Intronic
1092827348 12:12413547-12413569 TGATGACAATGGCGGTTTTGTGG - Intronic
1092843919 12:12566435-12566457 TGATGACAATGGCGGTTTTGTGG + Intergenic
1092996699 12:13957751-13957773 TGATGACGATGCAGGCTCTGCGG + Intronic
1093453398 12:19340480-19340502 TGATGACAATGGCGGTTTTGTGG + Intronic
1093927893 12:24926487-24926509 TGATGACAATGGCGGTTTTGTGG + Intronic
1093987248 12:25549459-25549481 AGATGACAATGGCAGTGTTGTGG + Exonic
1094103618 12:26785980-26786002 TGATGACAATGGCGGTTTTGTGG + Intronic
1094209509 12:27874389-27874411 GGATGACAATGGCGGTTTTGTGG + Intergenic
1094238882 12:28200741-28200763 TGATGACAATGGCGGTTTTGTGG - Intronic
1094241193 12:28226919-28226941 TGATGACCTTGACAGTTTTGAGG + Intronic
1094243431 12:28257224-28257246 TGATGATTTTGGTGGTTTTGAGG + Exonic
1094418875 12:30248776-30248798 TGATGACCTTGACTGTTTTGAGG - Intergenic
1094670223 12:32562880-32562902 GGATGACAATGGCGGTTTTGTGG - Intronic
1095068445 12:37814177-37814199 GGATGACAATGGCGGCTTTGTGG - Intergenic
1095440007 12:42228939-42228961 TGATGACAATGGCGGCTTTGTGG + Intronic
1095571346 12:43685857-43685879 GGATGACAATGGCGGTTTTGTGG + Intergenic
1096021875 12:48332168-48332190 GGATGACAATGGCGGCTTTGTGG - Intergenic
1096039234 12:48500191-48500213 GGATGACAATGGCGGCTTTGTGG - Intergenic
1096064069 12:48725093-48725115 TGATGACAATGGCGGTTTTGTGG + Intergenic
1096082659 12:48842825-48842847 TGATGACAGTGGCGGTTTTGTGG + Intronic
1096092927 12:48915578-48915600 GGATGACAATGGCGGCTTTGCGG - Intronic
1096146642 12:49283452-49283474 TGATGACAGTGGCGGTTTTGTGG - Intergenic
1096167188 12:49436109-49436131 TGATGACAATGGCGGTTTTGTGG - Intronic
1096225170 12:49861512-49861534 TGATGACAATGGCGGTTTTGTGG + Intergenic
1096557152 12:52410218-52410240 TGATGACAATGGCGGTTTTGTGG + Intergenic
1096660741 12:53122799-53122821 TGATGACAATGGCAGTTTTGTGG - Intronic
1096856465 12:54487948-54487970 GGATGACAATGGCCGTTTTGTGG - Intergenic
1096951485 12:55478929-55478951 TGATGACAATGGCGGTTTTGTGG - Intergenic
1097028395 12:56075562-56075584 GGATGACAATGGCGGCTTTGTGG - Intergenic
1097126790 12:56783108-56783130 TGATGACGATGGCGGTTTTGTGG - Intronic
1097127745 12:56788923-56788945 TGATGACGATGGCGGTTTTGTGG - Intergenic
1097149272 12:56964051-56964073 TGATGACAATGGCGGTTTTGTGG + Intergenic
1097230319 12:57507318-57507340 TGATGACAATGGCGGTTTTGTGG - Intronic
1097779633 12:63687115-63687137 TGATGACAATGGTGGTTTTGTGG + Intergenic
1097944989 12:65357683-65357705 TGATGACCTTGGCAGGTTTGAGG + Intronic
1098019287 12:66135589-66135611 TGATGACAATGGCGGTTTTGTGG + Intronic
1098370820 12:69759450-69759472 TGATGACGATGGCGGTTTTGTGG - Intronic
1098413193 12:70203289-70203311 TGATGACAATGGCGGTTTTGTGG + Intergenic
1098884066 12:75942640-75942662 TGATGACAATGGCGGTTTTGTGG + Intergenic
1099971440 12:89504134-89504156 TGATGACGATGGCGGTTTTGTGG + Intronic
1100003616 12:89867563-89867585 TGATGACAATGGCGGTTTTGTGG - Intergenic
1100064780 12:90629003-90629025 TGATGACGATGATGGTTCAGGGG - Intergenic
1100507337 12:95235124-95235146 TGATGACAATGGCGGTTTTGTGG - Intronic
1100570217 12:95840306-95840328 TGATGACAATGGCGGTTTTGTGG - Intergenic
1100577483 12:95907290-95907312 TGATGACAATGGCAGTTTTGTGG - Intronic
1100582547 12:95948658-95948680 GGATGACAATGGCGGCTTTGTGG + Intronic
1100752265 12:97711575-97711597 TGATGACCGTGACAGTTTTGAGG - Intergenic
1100845627 12:98655296-98655318 GGATGACAATGGCGGCTTTATGG - Intronic
1100994884 12:100293995-100294017 GGATGACAATCGCGGCTTTGTGG - Intronic
1101317705 12:103644059-103644081 TGATGACAGTGGCGGTTTTGTGG + Intronic
1101393305 12:104323270-104323292 GGATGACAATGGCGGCTTTGTGG - Intronic
1101885358 12:108656578-108656600 TGATGACGATGGCGGTTTTGTGG + Intronic
1102089507 12:110173491-110173513 TGATGACAATGGTGGTTTTGTGG + Intronic
1102174532 12:110866785-110866807 GGATGACAATGGCGGCTTTGTGG - Intronic
1102186086 12:110950410-110950432 TGATGACAATGGCGGTTTTGTGG - Intergenic
1102243745 12:111342012-111342034 TGATGACGGTGTTGGTCTTGAGG - Exonic
1102268395 12:111507688-111507710 TGATGACAATGGCGGCTTTGTGG + Intronic
1102293771 12:111722852-111722874 GGATGACAATGGCGGCTTTGTGG - Intronic
1102578878 12:113873207-113873229 GGATGACAATGGCGGCTTTGTGG + Intronic
1102656214 12:114484725-114484747 TGATGACAATGGCGGTTTTGTGG - Intergenic
1103234346 12:119360000-119360022 GGATGACAATGGCGGCTTTGTGG - Intronic
1103299622 12:119918272-119918294 GGATGACAATGGCGGCTTTGTGG - Intergenic
1103413952 12:120732102-120732124 TGATGACGATGGCAGTTTTGTGG - Intronic
1103457467 12:121077153-121077175 TGATGACAATGGCAGTTTTGTGG + Intergenic
1103514383 12:121497676-121497698 TGATGACCTTGACAGTTTTGAGG - Intronic
1103535961 12:121634157-121634179 TGATGACAATGGCGGTTTTGTGG - Intronic
1103591575 12:121994485-121994507 GGATGACAATGGCGGCTTTGTGG + Intronic
1103641909 12:122357966-122357988 TGATGACAATGGCGGTTTTGTGG + Intronic
1103682863 12:122708722-122708744 TGATGACAATGGCGGTTTTGTGG - Intergenic
1103872446 12:124101613-124101635 TGATGACAATGGCGGTTTTGTGG - Intronic
1103934367 12:124467544-124467566 TGAGGACGATGGGGGTGATGAGG - Intronic
1104029327 12:125053394-125053416 TGATGACGATGGCGGTTTTGTGG - Intergenic
1104524305 12:129504138-129504160 TGATGATGATGACGGTGATGAGG - Intronic
1104712401 12:130996243-130996265 GGATGACAATCGCGGCTTTGTGG - Intronic
1104861381 12:131926201-131926223 TGATGACAATGGCGGTTTTGTGG - Intergenic
1105248579 13:18674234-18674256 TGATGACAATGGCGGTTTTGTGG + Intergenic
1105368194 13:19780339-19780361 GGATGACAATGGCGGCTTTGTGG + Intronic
1105526891 13:21186183-21186205 GGATGACAATGGCGGTTTTGTGG - Intergenic
1105556229 13:21448745-21448767 GGATGACAATGGTGGCTTTGTGG + Intronic
1105677473 13:22687785-22687807 TGATGACCTTGACAGTTTTGAGG + Intergenic
1105692746 13:22858874-22858896 TGATGACAATGGCGGTTTTGTGG - Intergenic
1105808317 13:23972388-23972410 TGATGACAATGGCGGTTTTGTGG - Intergenic
1105921661 13:24970140-24970162 TGATGACAGTGGCGGTTTTGTGG - Intergenic
1105976665 13:25479958-25479980 TGATGACAATGGTGGTTTTGTGG - Intronic
1105980239 13:25512347-25512369 TGATGACAATGGCGGTTTTGTGG - Intronic
1106104922 13:26724343-26724365 TGATGACAATGGCGGTTTTGTGG + Intergenic
1106114533 13:26806136-26806158 TGATGACAATGGCGGTTTAGTGG - Intergenic
1106495477 13:30270449-30270471 TGATGACAATGGCGGTTTTGTGG + Intronic
1106559884 13:30839050-30839072 TGATGACAATGGCGGTTTTGTGG - Intergenic
1106680309 13:32000651-32000673 GGATGGCAATGGCGGTTTTGTGG + Intergenic
1106747116 13:32717218-32717240 TGATGACAATGGCGGTTTTGTGG + Intronic
1106867102 13:33977101-33977123 TGATGACCTTGACAGTTTTGAGG - Intergenic
1106885676 13:34181653-34181675 GGATGACAATGGCGGCTTTGTGG + Intergenic
1106918942 13:34541496-34541518 GGATGACAATGGCGGCTTTGTGG + Intergenic
1107166044 13:37280915-37280937 GGATGACAATGGCGGCTTTGTGG + Intergenic
1107493464 13:40901423-40901445 TGATGACAATGGCAGTTTTGTGG + Intergenic
1107499216 13:40956100-40956122 TGATGACAATGGCGGTTTTGTGG + Intronic
1107588740 13:41881530-41881552 TGATGACAATGGCGGTTTTGTGG - Intronic
1107692553 13:42966806-42966828 GGATGACAATGGCGGCTTTGTGG + Intronic
1107863378 13:44682230-44682252 TGATGACAGTGGCAGTTTTGTGG - Intergenic
1107953186 13:45485067-45485089 GGATGACAATGGCAGCTTTGTGG - Intronic
1108024483 13:46163165-46163187 GGATGACAATGGCGGTTTTGTGG + Intronic
1108059087 13:46515361-46515383 GGATGACAATGGCGGCTTTGTGG - Intergenic
1108330670 13:49379223-49379245 GGATGACAATGGCGGCTTTGTGG + Intronic
1108341859 13:49504742-49504764 GGATGACAATCGCGGCTTTGTGG + Intronic
1108351655 13:49593751-49593773 GGATGACAATGGCGGCTTTGTGG + Intergenic
1108370476 13:49762393-49762415 TGATGATGATGGCGGTTTTGTGG + Intronic
1108502158 13:51078438-51078460 TGATGACAGTGGCAGTTTTATGG + Intergenic
1108608896 13:52064649-52064671 GGATGACAATGGCGGTTTTGTGG + Intronic
1108610654 13:52080419-52080441 TGATGACAATGGCGGTTTTGTGG + Intronic
1109708712 13:66135348-66135370 TGATGACACTGACAGTTTTGAGG - Intergenic
1109929438 13:69195880-69195902 TGATGATGATGTGGATTTTGAGG + Intergenic
1110269714 13:73575734-73575756 GGATGACAATGGCTGCTTTGTGG + Intergenic
1110701085 13:78549965-78549987 TGATGACCTTGACAGTTTTGAGG - Intergenic
1110922263 13:81102537-81102559 TGATGACAATGGCGGTTTTGTGG + Intergenic
1111418093 13:87976077-87976099 GGATGACAATGGCGGCTTTGTGG - Intergenic
1111434525 13:88189342-88189364 TGATGACCTTGACGTTTTTGAGG - Intergenic
1112055858 13:95690452-95690474 TGATGACAATGGCGGTTTTGTGG - Intronic
1112420238 13:99242204-99242226 TGATGACAATGGCGGTTTTGTGG - Intronic
1112573943 13:100618956-100618978 GGATGACAATGGCGGTTTTGTGG - Intronic
1112590772 13:100761977-100761999 GGATGACAATGGCGGTTTTGTGG - Intergenic
1113194224 13:107783390-107783412 TGATGACAATGGTGGTTTTGTGG + Intronic
1113478855 13:110606125-110606147 TGATGACAATGGCGGTTTTGTGG - Intergenic
1113774037 13:112932349-112932371 TGATGACTTTGACAGTTTTGAGG - Intronic
1113915318 13:113867232-113867254 TGATGACAATGGCGGTTTTGGGG + Intergenic
1114165419 14:20213299-20213321 TGATGACAGTGGCAGTTTTGTGG + Intergenic
1114175057 14:20310802-20310824 GGATGACAATGGCGGTTTTGTGG + Intergenic
1114199540 14:20507141-20507163 TGATGACAATGGCGGTTTTGTGG + Intronic
1114280514 14:21188993-21189015 TGATGACAATGGCGGTTTTGTGG + Intergenic
1114428074 14:22638180-22638202 TGATGACAATGGCGGTTTTGTGG + Intergenic
1114428369 14:22639512-22639534 GGATGACAATGGCGGCTTTGTGG + Intergenic
1114467245 14:22931812-22931834 TGATGACTTTGGTAGTTTTGAGG + Intergenic
1114508098 14:23232936-23232958 TGATGACGATGGTGGTTTTGTGG + Intronic
1115065522 14:29255885-29255907 TGATGACATTGACAGTTTTGGGG + Intergenic
1115099874 14:29685930-29685952 TGATGATGATAGCTGATTTGGGG + Intronic
1115120273 14:29928733-29928755 TGATGACGGTGGCGGTGCTGAGG - Intronic
1115259264 14:31436876-31436898 TGATGACAGTGGCGGTTTTGTGG - Intronic
1115504379 14:34079315-34079337 TGATGACAATGGCGGTTTTGTGG + Intronic
1115540131 14:34412038-34412060 TGATGACAATGGCGGTTTTGTGG + Intronic
1115610007 14:35039786-35039808 GGATGACAATGGCGGCTTTGTGG + Intergenic
1115622236 14:35152397-35152419 TGATGATGATGGCGGTTTTGTGG - Intronic
1115688800 14:35824421-35824443 GGATGACAATGGCGGCTTTGTGG - Intergenic
1115703224 14:35976611-35976633 TGATGACAATGGCGGTTTTGTGG - Intergenic
1115847408 14:37555108-37555130 TGAAGAGAATGGCGGTTTTGTGG - Intergenic
1116005157 14:39285217-39285239 GGATGACGATGGCGGTTTTGTGG - Intronic
1116191390 14:41673182-41673204 TGATGACAATGGCGGTTTTGTGG - Intronic
1116409217 14:44601761-44601783 TGATGACGATGGCGGTTTTGTGG + Intergenic
1116480830 14:45390357-45390379 GGATGACAATGGCGGCTTTGTGG + Intergenic
1116621596 14:47211144-47211166 TGGTTACGATGGTGGGTTTGGGG - Intronic
1116734128 14:48667360-48667382 TGAGGGCTATGGCAGTTTTGAGG - Intergenic
1116841357 14:49821837-49821859 TGATGACAATGGCGGTTTTGTGG + Intronic
1116871771 14:50074439-50074461 GGATGACAATGGCGGCTTTGTGG + Intergenic
1116902598 14:50375947-50375969 TGATGACTCTGGCAGTTTTCAGG - Intronic
1117277478 14:54204430-54204452 TGATGACAATGGCGGTTTTGTGG + Intergenic
1117411601 14:55456162-55456184 TGATGACAATGGCGGTTTTGTGG - Intronic
1117597093 14:57334324-57334346 TGATGACAATGGCGGTTTTGTGG + Intergenic
1117716726 14:58588676-58588698 GGGTGACAATGGCGGCTTTGTGG + Intergenic
1117763610 14:59058756-59058778 TGATGACAATGGCGATTTTGTGG - Intergenic
1118148887 14:63166345-63166367 GGATGACAATCGCGGCTTTGTGG + Intergenic
1118184365 14:63523236-63523258 TGATGACAATGGCGGTTTTGTGG + Intronic
1118209168 14:63750885-63750907 TGATGACGATGGCAGTTTTGTGG - Intergenic
1118238820 14:64037598-64037620 TGATGACAATGGCGGTTTTGTGG - Intronic
1118340713 14:64894610-64894632 TGATGACAATGGCGGTTTTGTGG - Intergenic
1118423655 14:65634091-65634113 TGATGACAATGGCGGTTTTGTGG + Intronic
1118428349 14:65692068-65692090 TGATGACAATGGCGGTTTTGTGG - Intronic
1118455503 14:65942454-65942476 TGATAATGTTGGCAGTTTTGAGG + Intergenic
1118517350 14:66545045-66545067 TGATGACAATGGCGGTTTTGTGG - Intronic
1118584811 14:67341712-67341734 TGATGACAATGGCGGTTTTGTGG + Intronic
1119254133 14:73183764-73183786 GGATGACAATGGCGGCTTTGTGG - Intronic
1119594778 14:75924750-75924772 GGATGACAATGGCGGTTTTGTGG - Intronic
1119698533 14:76734447-76734469 TGATGACAATGGCGGTTTTGTGG - Intergenic
1119700489 14:76750900-76750922 GGATGACAATGGCGGTTTTGTGG + Intergenic
1119711057 14:76822249-76822271 GGATGACAATGGCGGTTTTGTGG + Intronic
1119797991 14:77416669-77416691 TGATGACAATGGCGGTTTTGTGG - Intronic
1119799976 14:77435315-77435337 TGTTGAGGATGGAGGCTTTGCGG + Exonic
1119868428 14:77993491-77993513 TGATGACAATGGCGGTTTTGTGG - Intergenic
1120087224 14:80287147-80287169 TGATGACAATGGCGGTTTTGTGG + Intronic
1120505706 14:85352503-85352525 TGATGACAAAGGCGGTTTTGTGG - Intergenic
1120547507 14:85829627-85829649 TGATGACAATGGCGGTTTTGTGG - Intergenic
1120893124 14:89506653-89506675 GGATAACAATCGCGGTTTTGTGG + Intronic
1121142666 14:91557000-91557022 GGATGACAATGGCGGTTTTGTGG - Intergenic
1121260445 14:92562101-92562123 TGATGACCTTGGCAGTTTTGAGG + Intronic
1121306507 14:92911179-92911201 GGATGACAATGGCGGCTTTGTGG - Intergenic
1121531678 14:94658411-94658433 TGATGACAATGGCGGTTTTGTGG + Intergenic
1122212476 14:100181457-100181479 GGATGACAATGGCGGCTTTGTGG + Intergenic
1122238341 14:100345199-100345221 TGATGACAATGGCAGTTTTGTGG + Intronic
1122497803 14:102172374-102172396 TGATGACAATGGTGGTTTTGTGG - Intronic
1122568016 14:102676177-102676199 TGATGACAATGGCGGTTTTGTGG - Intronic
1122807722 14:104268968-104268990 TGATGACCTTGACAGTTTTGGGG + Intergenic
1122957683 14:105079066-105079088 TGATAACAATGGTGGTTTTGTGG - Intergenic
1122963488 14:105111249-105111271 GGATGACAATGGCGGCTTTGTGG - Intergenic
1202848178 14_GL000009v2_random:200334-200356 TCATGACAATGGCGGTTTTGTGG + Intergenic
1202917687 14_GL000194v1_random:191003-191025 TCATGACAATGGCGGTTTTGTGG + Intergenic
1123909018 15:24948684-24948706 TGATGACCTTGACAGTTTTGGGG + Intronic
1124132492 15:27003689-27003711 TGATGACAATGGCGGTTTTGTGG - Intronic
1124162941 15:27290650-27290672 TGATGACCTTGACAGTTTTGAGG - Intronic
1124217560 15:27820521-27820543 TGATGACCTTGACAGTTTTGAGG - Intronic
1124246003 15:28070690-28070712 GGATGACAATGGCGGCTTTGTGG + Intronic
1125079609 15:35657099-35657121 GGATGACAATGGCGGCTTTGTGG + Intergenic
1125459305 15:39893570-39893592 GGATGACAATGGCGGCTTTGTGG - Intronic
1125482293 15:40089070-40089092 TGAAGACGGTGGAGGCTTTGTGG - Exonic
1125566938 15:40683775-40683797 TGATGACAATGGCAGTTTTGTGG + Intergenic
1125651609 15:41321451-41321473 TGATGACAATGGCAGTTTTGTGG + Intronic
1125659618 15:41383562-41383584 GGATGACAATGGCGGCTTTGTGG + Intergenic
1125861736 15:43005619-43005641 TGATGACGATGGCGGTTTTGTGG + Intronic
1125863001 15:43015170-43015192 TGATGATAATGGTGGTTTTGTGG + Intronic
1125868662 15:43077179-43077201 TGATGACAATGGCGGTTTTGTGG + Intronic
1125877895 15:43167002-43167024 TGATGACAATGGCGGTTTTGTGG - Intronic
1126125616 15:45292876-45292898 TGATGACAATGGCGGTTTTGCGG - Intergenic
1126212032 15:46110940-46110962 TGATGACCTTGACAGTTTTGAGG + Intergenic
1126295870 15:47133733-47133755 TGATGACAATGGCGGTTTTGTGG + Exonic
1126516908 15:49549786-49549808 TGATGACAATGGCGGTTTTGTGG - Intronic
1126562855 15:50062895-50062917 TTAGGACAATGGCGTTTTTGTGG + Intronic
1126571696 15:50158632-50158654 TGATGACAATGGCGGTTTTGTGG + Intronic
1126692015 15:51294849-51294871 TGATGACAATGGCGGTTTTGTGG + Intronic
1126799539 15:52286468-52286490 TGATGACAATGGCAGTTTTGTGG + Intronic
1127073366 15:55303990-55304012 GGATGACAATGGCGGCTTTGTGG + Intronic
1127088340 15:55445505-55445527 TGATGACGATGGCGGTTTTGTGG - Intronic
1127154652 15:56111175-56111197 GGATGACAATGGCGGTTTTGTGG + Intronic
1127584785 15:60367839-60367861 TGATGACAATGGCAGTTTTGTGG + Intronic
1127782789 15:62332041-62332063 GGATGACAATGGCGGTTTTGTGG - Intergenic
1127874398 15:63099306-63099328 TGATGACAATGGCGGTTTTGTGG + Intergenic
1128071224 15:64798887-64798909 TGATGACAATGGTGGTTTTGTGG - Intergenic
1128198618 15:65784191-65784213 TGATGACTTTGATGGTTTTGAGG - Intronic
1128489565 15:68134201-68134223 TGATGACAATGGCGGTTTTGTGG - Intronic
1128586771 15:68859365-68859387 TGATGACAATGGCAGTTTTGTGG - Intronic
1128597240 15:68964142-68964164 TGATGACAATGGCGGTTTTGTGG - Intronic
1128938710 15:71769444-71769466 GGATGACAATGGCGGCTTTGTGG + Intronic
1128970666 15:72102016-72102038 GGATGACAATGGCGGCTTTGTGG + Intronic
1129008942 15:72397172-72397194 TGATGACAATGGCGGTTTTGTGG + Intergenic
1129053966 15:72806793-72806815 TGATGACAATGGCGGTTTTGTGG - Intergenic
1129313895 15:74729347-74729369 TGATGACAATGGCGGTTTTGTGG + Intergenic
1129341238 15:74888267-74888289 TGATGACAATGGCAGTTCTGTGG - Intergenic
1129428691 15:75481985-75482007 GGATGACAATGGCGGCTTTGTGG + Intronic
1129431878 15:75504988-75505010 GGATGACAATGGCGGTTTTGTGG + Intronic
1129812251 15:78520705-78520727 TGATGACAATGGCGGTTTTGTGG - Intronic
1130180191 15:81619190-81619212 TGATGACCTTGACAGTTTTGGGG + Intergenic
1130340555 15:82997669-82997691 GGATGACAATGGCGGCTTTGTGG - Intronic
1130428115 15:83821709-83821731 TGACGACAACGGCGGTTTTGTGG - Intronic
1130522503 15:84673281-84673303 TGATGACAATGGCGGTTTTGTGG + Intronic
1130946089 15:88552190-88552212 GGATGACAATGGCGGCTTTGTGG - Intergenic
1131001120 15:88941215-88941237 GGATGACAATGGCGGCTTTGTGG - Intergenic
1131043725 15:89296661-89296683 CGATGACAATGGCGGTTTTGTGG - Intronic
1131125708 15:89855054-89855076 GGATGACAATGACGGCTTTGTGG + Intronic
1131127691 15:89869098-89869120 GGATGACAATGGCGGCTTTGTGG + Intronic
1131141246 15:89978279-89978301 GGATGACAATGGCGGTTTTGTGG + Intergenic
1131459305 15:92607080-92607102 TGATGACAATGGTGGTTTTGTGG + Intergenic
1131479179 15:92767939-92767961 GGATGACAATCGCGGCTTTGTGG - Intronic
1132036911 15:98492862-98492884 GGATGACAATGGCGGTTTTGTGG - Intronic
1132300688 15:100774009-100774031 TGATGACAATGGCGGTTTTGTGG - Intergenic
1132361280 15:101218137-101218159 TGATGATCTTGACGGTTTTGAGG - Intronic
1132494976 16:258621-258643 TGATGACAATGGCGGTTTTGTGG - Intronic
1132777052 16:1599980-1600002 GGATGACAATGGCGGCTTTGTGG + Intronic
1132921749 16:2399778-2399800 TGATGACAATGGCGGTTTTGTGG - Intergenic
1132992149 16:2801807-2801829 TGATGACAATGGCGGTTTTGTGG - Intergenic
1133074669 16:3271268-3271290 TGATGACAATGGCGGTTTTGTGG - Intronic
1133299648 16:4774821-4774843 TGATGACAATGGCGGTTTTGTGG - Intergenic
1133364714 16:5202214-5202236 TGATGACAATGGCGGTTTTGTGG - Intergenic
1133659554 16:7903221-7903243 GGATGACAATGGCGGTTTTGTGG - Intergenic
1133680500 16:8115450-8115472 TGATGACAATGGAGGTTTTGTGG + Intergenic
1133751919 16:8732688-8732710 GGATGACAATGGCGGTTTTGTGG - Intronic
1133867232 16:9655561-9655583 TGATGATGATGGTGATTCTGGGG + Intergenic
1134082595 16:11335551-11335573 TGATGACAATGGCAGTTTTGTGG - Intronic
1134324707 16:13196457-13196479 TGATGACTTTGACAGTTTTGAGG - Intronic
1134471775 16:14532633-14532655 TGATGACAATGGCGGTTTTGTGG - Intronic
1134854088 16:17505480-17505502 CGATGACAATGGCGGTTTTGTGG - Intergenic
1135026605 16:19003559-19003581 GGATGACAATGGCGGCTTTGTGG + Intronic
1135639494 16:24108819-24108841 GGATGACAATGGCGGCTTTGTGG - Intronic
1135694229 16:24573950-24573972 TGATGATGACGGCGGTTTTGTGG - Intergenic
1136160835 16:28417344-28417366 GGATGACAATGGCGGCTTTGTGG + Intergenic
1136197649 16:28665926-28665948 GGATGACAATGGCGGTTTTGTGG - Intergenic
1136202131 16:28697656-28697678 GGATGACAATGGCGGCTTTGTGG - Intronic
1136213988 16:28780063-28780085 TGATGACAGTGGCGGTTTTGTGG - Intergenic
1136258723 16:29059987-29060009 TGATGACAGTGGCGGTTTTGTGG - Intergenic
1136319799 16:29476538-29476560 TGATGACAGTGGCGGTTTTGTGG + Intergenic
1136426416 16:30170440-30170462 GGATGACAATGGCGGCTTTGTGG + Intergenic
1136434370 16:30215879-30215901 TGATGACAGTGGCGGTTTTGTGG + Intergenic
1136583696 16:31169830-31169852 TGATGACAGTGGCGGTTTTGTGG + Intergenic
1136593800 16:31232947-31232969 TGATGACAGTGGCGGTTTTGTGG + Intergenic
1136611438 16:31369074-31369096 TGATGACAATGGCGGTTTTGTGG - Intronic
1136668713 16:31836925-31836947 GGATGACAATGGCGGCTTTGTGG + Intergenic
1136918859 16:34245571-34245593 TGATGATGATGGTGGTTTTGTGG - Intergenic
1136930422 16:34413034-34413056 TGACAACGATGGCGGTTTTGTGG - Intergenic
1136974152 16:34998774-34998796 TGACAACGATGGCGGTTTTGTGG + Intergenic
1137240698 16:46653127-46653149 TGATGACAATGGCGGTTTTGTGG - Intergenic
1137244839 16:46694326-46694348 GGATGACAATGGCAGCTTTGTGG - Intronic
1137284093 16:47000818-47000840 GGATGACAATGGCGGCTTTGTGG + Intergenic
1137304095 16:47181710-47181732 TGATGACAATGGCGGTTTTGTGG + Intronic
1137400607 16:48151329-48151351 TGATGACCTTGACAGTTTTGAGG - Intronic
1137493656 16:48952272-48952294 GGATGACAGTGGCGGCTTTGTGG + Intergenic
1137522900 16:49210122-49210144 TGATGACAATGGCAGTTTTGTGG - Intergenic
1137761703 16:50946281-50946303 TGATGACCTTGACAGTTTTGAGG - Intergenic
1137790038 16:51167248-51167270 TGATGATGATGGTGGTAGTGAGG + Intergenic
1138028385 16:53539787-53539809 TGATGACAATGGCAGTTTTGTGG + Intergenic
1138043695 16:53698916-53698938 TGATGACAATGGTGGTTTTGTGG + Intronic
1138319545 16:56100190-56100212 TGATGACCTTGACCGTTTTGAGG - Intergenic
1138400123 16:56739182-56739204 GGATGACAATGGCGGCTTTGTGG - Intronic
1138466971 16:57200372-57200394 TGATGACAATGGCGGTTTTGTGG - Intronic
1138628331 16:58271588-58271610 TGATGACCTTGACAGTTTTGAGG + Intronic
1138642074 16:58395798-58395820 GGATGACAATGGCGGCTTTGTGG - Intronic
1138699205 16:58845965-58845987 TGATGACAGTGGCGGTTTTGTGG - Intergenic
1138880462 16:61007909-61007931 TGATGACACTGACAGTTTTGAGG + Intergenic
1139394908 16:66631458-66631480 TGATGACAATGGCAGTGTTGTGG + Intronic
1139623067 16:68163204-68163226 TGATGACAATGGCGGTTTTGTGG - Intronic
1139771379 16:69280328-69280350 TGATGACAATGGCGGTTTTGTGG - Intronic
1139864768 16:70052476-70052498 TGATGACAATGGCGGTTTTGTGG + Intergenic
1139885748 16:70205481-70205503 GGATGACAATGGCGGCTTTGTGG + Intergenic
1139887928 16:70224635-70224657 TGATGACAATGGCGGTTTTGTGG - Intergenic
1140029493 16:71323746-71323768 TGATGACCTTGACAGTTTTGAGG - Intergenic
1140063359 16:71589776-71589798 TGATGACAATGGCAGTTTTGTGG + Intergenic
1140161261 16:72497048-72497070 TGATGACAATGGCGGTTTTGTGG + Intergenic
1140482551 16:75269608-75269630 TGATGACCTTGACAGTTTTGAGG + Intergenic
1140994515 16:80244336-80244358 GGATGACAATGGCGGCTTTGTGG + Intergenic
1141319790 16:82996769-82996791 TGATGACGATGGTGATGGTGGGG + Intronic
1141411204 16:83834405-83834427 TGATGACCTTGGTAGTTTTGAGG - Intergenic
1141728689 16:85808079-85808101 TGATGACAACGGCGGTTTTGTGG - Intergenic
1141748414 16:85941866-85941888 TGATGACGCTGATGGTTTTGAGG + Intergenic
1142332476 16:89463201-89463223 TGATGACAGTGGCGGTTTTGTGG + Intronic
1142391897 16:89806816-89806838 TGATGACAATGGCGGTTTTATGG - Intronic
1142529950 17:572556-572578 TGATGACAATGGCGGTTTTGTGG + Intronic
1142533812 17:599279-599301 TGATGACAATGGCGGCTTTGTGG + Intronic
1142634188 17:1246990-1247012 TGATGACAGTGGCAGTTTTGTGG - Intergenic
1142657344 17:1403112-1403134 TGATGACAATGGCGGTTTTGTGG - Intergenic
1142704914 17:1689042-1689064 GGATGACAATGGCGGCTTTGTGG - Intergenic
1142789901 17:2255711-2255733 TGATGACGATGGCGGTTTTGTGG + Intronic
1142818943 17:2448271-2448293 TGATGACAATGGCGGTTTTGTGG + Intronic
1142825570 17:2507654-2507676 TGATGACAATGGCGGTTTTGTGG + Intronic
1142913038 17:3112304-3112326 TGATGACAATGGCGGTTTTGTGG - Intergenic
1142939517 17:3371083-3371105 TGATGACAATGGTGGTTTTGTGG - Intergenic
1142949421 17:3465306-3465328 TGATGACAATGGCGGTTTTGTGG + Intronic
1142963154 17:3564146-3564168 TGATGACAATGGCGGTTTTGTGG - Intergenic
1142974208 17:3633795-3633817 TGATGACAATGGCGGTTTTGTGG + Intronic
1143008910 17:3854630-3854652 TGATGACAATGGCGGTTTTGTGG + Intergenic
1143115216 17:4578274-4578296 GGATGACAATGGCAGTTTTGTGG - Intergenic
1143206465 17:5143282-5143304 TGACGACAATGGCGGTTTTGTGG + Intronic
1143277239 17:5721312-5721334 GGATGACAATGGCGGTTTTGTGG - Intergenic
1143342860 17:6226606-6226628 GGACGACAATGGCGGCTTTGTGG + Intergenic
1143689735 17:8550668-8550690 GGATGACAGTGGCGGCTTTGTGG + Intronic
1143994709 17:10996638-10996660 TGATGACAGTGGCAGCTTTGGGG - Intergenic
1144482242 17:15637775-15637797 GGATGACAATGGCGGCTTTGTGG + Intronic
1144510149 17:15867899-15867921 TGATGACAATGGCGGTTTTGTGG + Intergenic
1144524539 17:15979455-15979477 TGATGACAATGGCGGTTTTGTGG - Intronic
1144536588 17:16095854-16095876 TGATGACGATGGCGGTTTTGTGG + Intronic
1144559690 17:16311924-16311946 TGATGACGATGGCGGTTTTGTGG - Intronic
1144716808 17:17442126-17442148 GGATGACAATGGCGGCTTTGTGG - Intergenic
1144719721 17:17460300-17460322 TGATGGTGATGGCGGTGATGTGG - Intergenic
1144786057 17:17832208-17832230 TGATGAAGATGACGGCCTTGAGG - Intronic
1144798890 17:17912121-17912143 TGATGACAGTGGCGGTTTTGTGG - Intronic
1144860549 17:18298581-18298603 TGATGACAATGGAGGTTTTGTGG + Intronic
1144934632 17:18888313-18888335 GGATGACAATGGCGGCTTTGTGG - Intronic
1145022401 17:19441936-19441958 TGATGACAATGGCGGTTTTGTGG + Intergenic
1145027146 17:19476229-19476251 TGATGACAATGGCGGTTTGGTGG + Intergenic
1145047081 17:19627590-19627612 GGATGACAATGGCGGCTTTGTGG - Intergenic
1145174306 17:20685617-20685639 TGATGACAATGGCAGTTTTGTGG + Intergenic
1145206325 17:20985726-20985748 GGATGACAATGGCGGCTTTGTGG + Intergenic
1145295645 17:21590687-21590709 TGATGACAATGGCAGTTTTGTGG + Intergenic
1145418283 17:22741715-22741737 TGATGACAATGGCGGTTTTGTGG + Intergenic
1145684651 17:26639374-26639396 GGATGACAGTGGCGGTTTTGTGG + Intergenic
1145717357 17:27034353-27034375 GGATGACAATGGCGGCTTTGTGG + Intergenic
1145733908 17:27212838-27212860 TGATGACAATGGCGGTTTTGTGG + Intergenic
1145863210 17:28224806-28224828 GGATGACAATGGCGGCTTTGTGG + Intergenic
1145895562 17:28455877-28455899 GGATGACAATGGCGGCTTTGTGG - Intronic
1145896259 17:28459292-28459314 TGATGACAATGGCGGTTTTGTGG + Intronic
1145920047 17:28603920-28603942 TGATGACAATGGCGGTTTTGTGG - Intronic
1146048769 17:29532812-29532834 TGATGACAATGGCGGTTTTGTGG - Intronic
1146155982 17:30523744-30523766 TGATGACAATGGCGGTTTTGTGG + Exonic
1146187697 17:30736194-30736216 TGATGACAATGGCGGTTTTGTGG - Intergenic
1146215793 17:30979074-30979096 TGATGACAATGGCGGTTTTGTGG - Intronic
1146443955 17:32921747-32921769 TGATGACAATGGCGGTTTTGTGG - Intergenic
1146695723 17:34907799-34907821 TGATGACAATGGCGGTTTTGTGG + Intergenic
1146731181 17:35194943-35194965 TGATGACGGTGGTGGTTTTGTGG - Intergenic
1147024286 17:37566162-37566184 GGATGACAATGGCGGCTTTGTGG + Intronic
1147109807 17:38253548-38253570 GGATGACAATGGCGGCTTTGTGG + Intergenic
1147172945 17:38631797-38631819 TGATGACAATGGCGGCTTTGTGG + Intergenic
1147220938 17:38930473-38930495 TGATGACAGTGGCGGTTTTGTGG - Intergenic
1147278548 17:39338065-39338087 TGATGACAATGGCGCTTTTGTGG + Intronic
1147622429 17:41876441-41876463 TGATGACAATGGCGGTTGTGTGG + Intronic
1147636072 17:41965111-41965133 TGAGGACGATGAGGCTTTTGGGG + Exonic
1147665697 17:42146137-42146159 TGATGACCTTGACAGTTTTGAGG - Intronic
1147669945 17:42171141-42171163 TGGTGAGGATGGTGGTTGTGGGG + Intronic
1147709157 17:42449559-42449581 TGATGACAATGGCGGTTTTGTGG + Intergenic
1147785223 17:42973521-42973543 GGATGACAATGGCGGCTTTGTGG + Intronic
1147852503 17:43452719-43452741 TGATGACAATGGCGGTTTTGTGG + Intergenic
1147963675 17:44181354-44181376 GGATGACAATGGCGGCTTTGTGG + Intergenic
1147974562 17:44239114-44239136 TGATGACAATGGCGGTTTTGTGG + Intergenic
1148016506 17:44525274-44525296 TGATGACAATGGCAGTTTTGTGG + Intergenic
1148267455 17:46238045-46238067 GGATGACAATGGCGGCTTTGTGG - Intergenic
1148269532 17:46252840-46252862 TGATGACAATGGCGGTTTTGTGG - Intergenic
1148404498 17:47398389-47398411 TGATGACAATGGCGGTTTTGTGG + Intronic
1148406633 17:47421172-47421194 TGATGACAATGGCGGTTTTGTGG + Intronic
1148632987 17:49126027-49126049 TGATGACAATGGCGGTTTTGTGG + Intergenic
1148636143 17:49150450-49150472 TGATGACAATGGCGGTTTTGTGG + Intronic
1149624812 17:58073733-58073755 TGATGACAATGGCGGTTTTGTGG - Intergenic
1149633194 17:58143034-58143056 TGATGACAATGGCGGTTTTGTGG + Intergenic
1149780541 17:59393980-59394002 TGATGACAATGGCGGTTTTGTGG - Intronic
1149793768 17:59500677-59500699 GGATGACAATGGCGGCTTTGTGG + Intergenic
1149909300 17:60552400-60552422 TGATGACAATGGTGGCTTTGTGG + Intergenic
1150056380 17:62021155-62021177 TGATGACAATGGCGGTTTTGTGG - Intronic
1150134225 17:62686903-62686925 TGATGCAGATGGCAGATTTGGGG - Intronic
1150214164 17:63457206-63457228 TGATGACAATGGCGGTTTTGTGG + Intergenic
1150380669 17:64716878-64716900 GGATGACAATGGCGGTTTTGTGG + Intergenic
1150418623 17:65008245-65008267 TGAGGACTTTGGCAGTTTTGAGG - Intergenic
1150477310 17:65484763-65484785 AGATGACAATGGCGGTTTTGTGG + Intergenic
1150527499 17:65937945-65937967 TGATGACAGTGGCAGTTTTGTGG + Intronic
1150557863 17:66269499-66269521 GGATGACAATGGCGGCTTTGTGG + Intergenic
1150703940 17:67470730-67470752 GGATGACAATGGCGGCTTTGTGG + Intronic
1151168612 17:72226515-72226537 TGATGACTTTGACAGTTTTGAGG + Intergenic
1151409317 17:73910964-73910986 TGATGACCTTGACAGTTTTGGGG - Intergenic
1151935301 17:77257490-77257512 TGATGAGGATGGAGGTGATGGGG - Intergenic
1152020411 17:77777171-77777193 TGATGACAATGGCGGTTTTGTGG + Intergenic
1152129236 17:78465958-78465980 GGATGACAGTGGCGGCTTTGTGG + Intronic
1152340901 17:79723967-79723989 TGATGACATTGACAGTTTTGAGG - Intergenic
1152430778 17:80247309-80247331 TGATGACAATGGCGGTTTTGTGG - Intronic
1152478906 17:80537315-80537337 TGATGACAATGGCGGCTTTGTGG - Intergenic
1152487159 17:80602034-80602056 GGATGACAATGGCGGCTTTGTGG - Intronic
1152672806 17:81618732-81618754 TGATGACAATGGCAGTTTTGTGG + Intronic
1152792485 17:82288935-82288957 TGATGACCTTGGCAGTTTTGAGG - Intergenic
1152810049 17:82376992-82377014 TGATGACAATGGCGGTTTTGTGG + Intergenic
1153007594 18:512122-512144 TGATGACAATGGCGGTTTTGTGG - Intergenic
1153118707 18:1693328-1693350 TGATGACCTTGACAGTTTTGAGG + Intergenic
1153221660 18:2867817-2867839 TGATGACAATGGCGGTTTTGTGG - Intronic
1153605283 18:6827154-6827176 TGATGACAATGGCGGTTTTGTGG - Intronic
1153634198 18:7098995-7099017 TGATGACAATGGTGGTTTTGTGG + Intronic
1153843035 18:9024085-9024107 TGATGACAATGGCGGTTTTGTGG - Intergenic
1154158286 18:11960194-11960216 TGATGACAATGGCGGTTTTGTGG + Intergenic
1154265470 18:12874834-12874856 TGATGACAATGGTGGTTTTGTGG + Intronic
1154278060 18:12979535-12979557 TGATGACAATGGTGGTTTTGTGG - Intronic
1154289855 18:13098111-13098133 TGATGACAATGGCGGTTTTGTGG - Intronic
1154398084 18:14010424-14010446 GGATGACAATGGCGGCTTTGTGG - Intergenic
1154440156 18:14382642-14382664 TGATGACAATGGCGGTTTTGTGG - Intergenic
1154990041 18:21592137-21592159 TGATGACAATGGTGGTTTTGTGG - Intronic
1155082804 18:22427514-22427536 TGATGACCTTGACGTTTTTGAGG + Intergenic
1155911940 18:31513973-31513995 TCATGACCTTGACGGTTTTGAGG - Intronic
1155956799 18:31961164-31961186 TGATGACAATGGTGGTTTTGTGG + Intergenic
1156326156 18:36077362-36077384 TGATGACAATGGCGGTTTTGTGG - Intergenic
1157629139 18:49079871-49079893 GGATGACAATGGCGGTTTTGTGG - Intronic
1157640066 18:49203381-49203403 GGATGACAATGGCGGCTTTGTGG + Intronic
1157677131 18:49577484-49577506 GGATGACAATGGCGGCTTTGTGG - Intronic
1157705368 18:49800424-49800446 TGATGACCGTGGCGGTTTTGTGG + Intronic
1158148899 18:54344101-54344123 GGATGACAATGGCGGCTTTGTGG + Intronic
1158459136 18:57632545-57632567 TGATGACAATGGCGGTTTTGTGG - Intergenic
1158583996 18:58713457-58713479 TGATGACACTGACGGTTTTGAGG - Intronic
1159054386 18:63450238-63450260 TGATGACAATGGCGGTTTTGTGG - Intergenic
1159069550 18:63608161-63608183 TCATGACCTTGGCAGTTTTGAGG + Intergenic
1159157978 18:64608794-64608816 GGATGACAATCGCGGCTTTGTGG - Intergenic
1159329997 18:66980332-66980354 TGATGACTTTGGCAGTTCTGAGG + Intergenic
1159340361 18:67126653-67126675 GGATGACAATGGCGGTTTTGTGG - Intergenic
1159614811 18:70569482-70569504 TGATGACGATGGCAGTTTTGTGG - Intergenic
1159845672 18:73456822-73456844 TGATGACCTTGGCAGTTTTGAGG - Intergenic
1160108377 18:76001439-76001461 TGATGACAATGGCGGTTTTGTGG + Intergenic
1160182293 18:76645981-76646003 TGATGACAATGGCGGTTTTGTGG + Intergenic
1160228308 18:77028457-77028479 TGATGACAATGGCGGTTTTGTGG - Intronic
1160916422 19:1499080-1499102 TGATGACAGTGGCGGTTTTGTGG - Intergenic
1161685969 19:5702555-5702577 TGATGACAATGGCAGTTTTGTGG + Intronic
1161790393 19:6355999-6356021 TGATGACAATGGCGGTTTGGTGG + Intergenic
1162164046 19:8739954-8739976 TGATGACAATGGCGGTTTTGTGG + Intergenic
1162279090 19:9680452-9680474 TGATGACAATGGCGGTTTTGTGG + Intergenic
1162542079 19:11303084-11303106 GGATGACAATCGCGGCTTTGTGG + Intronic
1162695201 19:12468221-12468243 TAATGACAATGGCGGTTTTGTGG + Intronic
1162714576 19:12621883-12621905 GGATGACAATGGCGGCTTTGTGG + Intronic
1162887151 19:13704054-13704076 GGATGACAATGGCGGCTTTGCGG + Intergenic
1163143253 19:15363685-15363707 TGATGACAATGGCGGTTTTGTGG + Intronic
1163542480 19:17919018-17919040 TGATGACAATGGCGGTTTTGTGG + Intergenic
1163558357 19:18005457-18005479 TGATGACAATGGCGGTTTTGTGG - Intronic
1163904371 19:20138136-20138158 GGATGACAATGGCGGTTTTGTGG + Intergenic
1163905544 19:20149240-20149262 GGATGACAATGGCGGCTTTGTGG - Intergenic
1163906379 19:20152498-20152520 TGATGACAATGGCAGTTTTGTGG - Intergenic
1163909331 19:20175798-20175820 TGATGACAATGGCTGTTTTGTGG - Intronic
1163913198 19:20214821-20214843 TGATGACAATGGCGGTTTTGTGG + Intergenic
1163921850 19:20296742-20296764 TGATGACAATGGCAGTTTTGTGG + Intergenic
1163945116 19:20529548-20529570 TGATGACAACGGCGGTTTTGTGG - Intergenic
1164040137 19:21486792-21486814 TGACGACAATGGCGGTTTTGTGG - Intronic
1164043103 19:21511047-21511069 TGATGACAATGGCGGTTTTGTGG - Intronic
1164046864 19:21551123-21551145 TGATGACAATGGCGGTTTTGTGG - Intronic
1164054000 19:21606984-21607006 TGATGACAATGGCGGTTTTGTGG - Intergenic
1164066900 19:21722240-21722262 TGATGACAATGGCGGTTTTGTGG + Intergenic
1164071904 19:21776177-21776199 TGATGACAATGGCGGTTTTGTGG + Intergenic
1164081463 19:21865212-21865234 GGATGACAATGGCGGCTTTGTGG - Intergenic
1164105541 19:22106575-22106597 GGATGACAATGGCGGCTTTGTGG - Intergenic
1164186071 19:22871318-22871340 TGATGACAATGGCGGTTTTGTGG - Intergenic
1164192951 19:22928114-22928136 GGATGACAATGGCGGCTTTGTGG + Intergenic
1164214814 19:23134752-23134774 TGATGACAATGGCGGTTTTGTGG + Intronic
1164218735 19:23173545-23173567 TGATGACAATGGCGGTTTTGTGG + Intergenic
1164238868 19:23366034-23366056 TGATGACAGTGGTGGTTTTGTGG - Intronic
1164256536 19:23533302-23533324 TGATGACGATGGCGGTTTTGTGG - Intronic
1164264054 19:23595236-23595258 TGATGACAATGGCGGTTTTGTGG + Intronic
1164298328 19:23936924-23936946 TGATGACAATGGCGGTTTTGTGG - Intronic
1164301358 19:23964652-23964674 TGATGACGATGGTGGTTTTGTGG + Intergenic
1164652149 19:29898806-29898828 GGATGACAATGGCGGCATTGTGG - Intergenic
1165192732 19:34078955-34078977 GGATGACAATGGCGGCTTTGTGG - Intergenic
1165199624 19:34133247-34133269 TGATGACAATGGCGGTTTTGTGG + Intergenic
1165295304 19:34921898-34921920 TGATGACAATGGCGGTTTTGTGG - Intergenic
1165481742 19:36068822-36068844 TGATGACGATGGCGGTTTTGTGG - Intronic
1165541004 19:36491671-36491693 TGATGACAATGGCGGTGTTGTGG + Intergenic
1165727536 19:38123731-38123753 TGATGACAATGGCGGTTTTGTGG - Intronic
1165768213 19:38363931-38363953 TGATGACAATGGCGGTTTTGTGG - Intronic
1165842477 19:38797594-38797616 TGATGACAATGGCAGTTTTGCGG - Intergenic
1165851985 19:38855435-38855457 GGATGACAATGGCGGCTTTGTGG - Intergenic
1166028110 19:40107683-40107705 GGATGACAATGGCGGCCTTGTGG - Intergenic
1166030160 19:40118893-40118915 GGATGACAATGGCGGCTTTGTGG + Intergenic
1166114824 19:40647834-40647856 TGATGACAATGGCAGTTTTGTGG - Intergenic
1166162427 19:40964979-40965001 TGATGACAATGGCGGTTTTGTGG - Intergenic
1166180449 19:41103765-41103787 GGATGACAATGGCGGCTTTGTGG + Intergenic
1166192063 19:41181352-41181374 GGATGACAATGGCGGTTTTGTGG + Intergenic
1166261840 19:41645385-41645407 GGATGACAATGGCGGCTTTGTGG + Intronic
1166277970 19:41768566-41768588 TGATGACAATGGCAGTTTTGTGG - Intronic
1166417868 19:42610132-42610154 GGATGACAATGGCGGTTTTGTGG - Intronic
1166421283 19:42639270-42639292 TGATGACGATGGCGGTTTTGTGG - Intronic
1166425649 19:42676259-42676281 TGATGACAATGGTGGTTTTGTGG - Intronic
1166449706 19:42887861-42887883 TGTTGACGGTGGCGGTGGTGGGG + Intronic
1166532030 19:43548302-43548324 TGATGACGATGGCGGTTTTGTGG + Intronic
1166585307 19:43941401-43941423 TGATGACCTTGACAGTTTTGAGG + Intergenic
1166640318 19:44489266-44489288 TGATGACAATGGCGGTTTTGTGG + Intronic
1166708350 19:44921580-44921602 GGATGACAATCGCGGCTTTGTGG - Intergenic
1166832927 19:45648737-45648759 TGATGACAATGGCGGTTTTGTGG + Intergenic
1167038885 19:47010139-47010161 GGATGACAATGGCGGTTTTGTGG + Intergenic
1167541005 19:50086858-50086880 TGATGACAATGGCGGTTTTGTGG + Intergenic
1167548196 19:50141391-50141413 TGATGACAATGGCGGTTTTGTGG + Intergenic
1167567343 19:50264921-50264943 TGAGAAGGATGGAGGTTTTGGGG + Intronic
1167823795 19:51953175-51953197 TGATGACAATGGCGGTTTTGTGG + Intergenic
1167907844 19:52676654-52676676 GGATGACAATGGCGGCTTTGTGG + Intronic
1167924744 19:52812293-52812315 TGATGACAATGGCGGTTTTGTGG + Intronic
1167937552 19:52920217-52920239 TGATGACAATGGAGGTTTTGTGG + Intergenic
1167970470 19:53186415-53186437 TGATGACAATGGCGGTTTTGTGG - Intronic
1167975561 19:53223170-53223192 TGATGACAATGGCGGTTTTGTGG + Intergenic
1167980236 19:53269854-53269876 GGATGACAATGGCGGTTTTGTGG - Intergenic
1168017760 19:53587141-53587163 TGATGACAATGGCGGTTTTGTGG + Intergenic
1168114562 19:54214745-54214767 TGATGACAATGGCGGTTTTGTGG - Intronic
1168572784 19:57483744-57483766 GGATGACAATGGCGGTTTTGTGG + Intergenic
1168658534 19:58147922-58147944 TGATGACAATGGCGGTTTTGTGG + Intronic
1168695902 19:58404700-58404722 TGATGACAATGGCGGTTTTGTGG - Intronic
924971048 2:127156-127178 TGATGACAATGGCGGTTTTGTGG + Intergenic
925400411 2:3568970-3568992 TGATGACAATGGCGGTTTTGTGG - Intergenic
925776149 2:7338173-7338195 TGATGACAATGGCGGTTTTGTGG - Intergenic
926215248 2:10902416-10902438 GGATGACAATGGCGGCTTTGTGG - Intergenic
926639437 2:15219791-15219813 TGATGACAATGGCGGTTTTGTGG - Intronic
926667633 2:15542155-15542177 TGATGACAATGGCAGTTTTGTGG + Intronic
926674686 2:15611351-15611373 TGATGACAATGGCGGTTTTGTGG - Intronic
926683248 2:15680004-15680026 TGATGACAATGGCGGTTTTGTGG - Intergenic
927347267 2:22059997-22060019 TGATGACCTTGACAGTTTTGAGG + Intergenic
927730254 2:25464849-25464871 TCATGACCTTGGCAGTTTTGAGG - Intronic
927747489 2:25634584-25634606 GGATGACAATGGCGGTTTTGTGG + Intronic
927757738 2:25723091-25723113 GGATGACAATGGCGGTTTTGTGG - Intergenic
927776800 2:25910182-25910204 TGATGACAATGGCGGTTTTGTGG - Intergenic
927832995 2:26370325-26370347 GGATGACAATGGCGGCTTTGTGG - Intronic
927897660 2:26795166-26795188 TGATGACAATGGCGGTTTTGTGG - Intronic
927978820 2:27359767-27359789 GGATGACAATGGCGGCTTTGTGG + Intergenic
928002808 2:27539583-27539605 TGATGACAATGGCGGTTTTGTGG - Intronic
928005054 2:27557179-27557201 CGATGACAATGGCGGTTTTGTGG - Intronic
928273330 2:29876790-29876812 TAATGATGATGGTGGTGTTGGGG + Intronic
928531825 2:32200381-32200403 CGATGACAATGGCGGTTTTGTGG + Intronic
928541918 2:32293557-32293579 CGATGACAATGGCGGTTTTGTGG - Intronic
928557843 2:32447219-32447241 TGATGACAATGGCGGTTTTGTGG - Intronic
928585424 2:32754611-32754633 TGATGACAATGGCGGTTTTGTGG - Intronic
928597523 2:32870060-32870082 GGATGACAATGGCGGCTTTGTGG + Intergenic
928889032 2:36180688-36180710 TGATGACAATGGCGGTTTTGTGG + Intergenic
929061854 2:37932529-37932551 TGATGACAATGGCGGTTTTGTGG - Intronic
929064928 2:37963782-37963804 TGATGACGATGGCGGTTTTGTGG - Intronic
929110841 2:38403908-38403930 TGATGACAATGGCGGTTTTGTGG + Intergenic
929151822 2:38755720-38755742 TGATGACAATGGCGGTTTTGTGG - Intronic
929238163 2:39627990-39628012 GGATGACAATGGCGGCTTTGTGG - Intergenic
929416573 2:41748224-41748246 GGATGACAATGGCGGCTTTGTGG + Intergenic
929445217 2:41995706-41995728 TGATGACAATGGTGGTTTTGTGG + Intergenic
929447628 2:42014197-42014219 GGATGACAATGGCGGCTTTGTGG - Intergenic
929515749 2:42605050-42605072 GGATGACAATGGCAGCTTTGTGG - Intronic
929577675 2:43062984-43063006 TGATGACAATGGTGGTTTTGTGG - Intergenic
929614829 2:43298125-43298147 GGATGACAATGGCGGCTTTGTGG + Intronic
929650692 2:43677665-43677687 TGATGACAATGGCGGTTTTGTGG - Intronic
929690015 2:44066813-44066835 TGATGACAATGGTGGTTTTGTGG - Intergenic
929740010 2:44589412-44589434 TGATGACAATGGCGGTTTTGTGG + Intronic
930079040 2:47432881-47432903 TGATGACAATGGCGGTTTTGTGG - Intronic
930201435 2:48555193-48555215 GGATGACAATGGCGGCTTTGTGG - Intronic
930208684 2:48614301-48614323 TGATGACGATGGCAGTTTTCTGG - Intronic
930396231 2:50828072-50828094 TGATGACAATGGCGGTTTTGTGG - Intronic
930665276 2:54095351-54095373 GGATGACAATGGCGGTTTGGTGG - Intronic
930667080 2:54110040-54110062 TGATGACCTTGACAGTTTTGAGG + Intronic
930668123 2:54119903-54119925 CGATGACGTTGGCAGTTTTAAGG + Intronic
930704050 2:54486248-54486270 GGATGACAATGGCGGTTTTGTGG + Intronic
930727957 2:54699341-54699363 TGATGACGATGGCGGTTTTGTGG + Intergenic
930821598 2:55651302-55651324 TGATGACAATGGCGGTTTTGTGG + Intronic
930827180 2:55705939-55705961 TGAAGACAATGGCGGTTTTGTGG + Intergenic
930833742 2:55773401-55773423 GGATGACAATGGCGGCTTTGTGG - Intergenic
931576540 2:63722812-63722834 GGATGACAATGGCGGCTTTGTGG + Intronic
931584362 2:63809439-63809461 TGATGACAATGGCGGTTTTGTGG + Intronic
931604772 2:64041796-64041818 TGATGACAATGGCGGTTTTGTGG - Intergenic
931655898 2:64511415-64511437 GGATGACAATGGCGGCTTTGTGG - Intergenic
931752166 2:65339253-65339275 TGATGACGATGGCGGTTTTCTGG + Intronic
931783438 2:65600421-65600443 TGATGACAATGGCGGTTTTGTGG - Intergenic
932367410 2:71161607-71161629 GGATGACAATGGCGGTTTTGTGG + Intergenic
932710547 2:74060981-74061003 TGATGACAGTGGCGGTTTTGTGG - Intronic
932807265 2:74795555-74795577 TGATGACAATGGCGGTTTTGTGG - Intergenic
932903473 2:75725316-75725338 TGATGACAATGGCGGTTTTGTGG + Intergenic
933735260 2:85488579-85488601 TGATGACAATGGCGGTTTTGTGG + Intergenic
933982907 2:87568069-87568091 TGATGACCTTGACAGTTTTGAGG - Intergenic
934309913 2:91852512-91852534 GGATGACAATGGTGGCTTTGTGG + Intergenic
934549162 2:95243870-95243892 TGATGACAATGGCGGTTTTGTGG + Intronic
934703889 2:96462629-96462651 GGATGACAATGGCAGCTTTGTGG + Intergenic
934752947 2:96805914-96805936 GGATGACAATGGTGGCTTTGTGG - Intronic
934998417 2:98988645-98988667 TGATGACGATGGCGGTTTTGTGG - Intergenic
935630407 2:105210132-105210154 TGATGACAATGGCGGTTTTGTGG - Intergenic
935636292 2:105251671-105251693 TGATGACAATGGCGGTTTTGTGG + Intergenic
935801440 2:106700813-106700835 TGATGACCTTGGCAGTTCTGAGG - Intergenic
935829273 2:106983470-106983492 TGATGACCTCGACGGTTTTGAGG + Intergenic
935991945 2:108727100-108727122 TGATGACAATGGCGGTTTTGTGG - Intronic
936134642 2:109879477-109879499 TGATGACCTTGACAGTTTTGGGG + Intergenic
936210055 2:110492008-110492030 TGATGACCTTGACAGTTTTGGGG - Intergenic
936310933 2:111382725-111382747 TGATGACCTTGACAGTTTTGAGG + Intergenic
936429248 2:112447480-112447502 TGATGACCTTGACAGTTTTGGGG - Intergenic
936504669 2:113096327-113096349 TGATGACAATGGCGGTTTTGTGG - Intergenic
936546640 2:113395532-113395554 GGATGACAATGGCGGCTTTGTGG + Intergenic
937168347 2:119843456-119843478 GGATGACAATGGCGGCTTTGTGG - Intronic
937437770 2:121893300-121893322 GGATGACAATGGGGGCTTTGTGG + Intergenic
937819877 2:126298018-126298040 TGATGACCTTGACAGTTTTGAGG - Intergenic
937919309 2:127119367-127119389 GGATGACAATGGCGGCTTTGTGG - Intergenic
937947594 2:127353770-127353792 TGATGACAATGGCAGTTTTGTGG + Intronic
938005505 2:127787324-127787346 GGATGACAGTGGCGGCTTTGTGG - Intronic
938088580 2:128418044-128418066 TGATGACAATGGCGGTTTTGTGG - Intergenic
938534311 2:132222363-132222385 TGATGACAATGGCGGTTTTGTGG + Intronic
938720784 2:134064495-134064517 TGATGATAATGGCGGTTTTGTGG + Intergenic
938821869 2:134968326-134968348 TGATGACAATGGCGGTTTTGTGG - Intronic
938828745 2:135033080-135033102 TGATGACAATGGCGGTTTTGTGG - Intronic
938891137 2:135706844-135706866 TGATGACAATGGCGGTTTTGTGG - Intronic
939186929 2:138872172-138872194 TGATGACAATGGCAGTTTTGTGG - Intergenic
939206162 2:139106656-139106678 GGATGTCAATGGCAGTTTTGTGG + Intergenic
939360431 2:141164646-141164668 TTATGATGATGTCTGTTTTGGGG + Intronic
939477349 2:142702827-142702849 TGATGACGATGGCGGTTTTGTGG + Intergenic
939578338 2:143921775-143921797 TGATGACAATGGTGGTTTTGTGG - Intergenic
939584873 2:143992061-143992083 TGATGACAATGGTGGTTTTGTGG + Intronic
940269467 2:151875460-151875482 TGATGACGATGGCGGTTTTGTGG - Intronic
940299358 2:152161025-152161047 TGATGACGGTGGCGGTTTTGTGG + Intronic
940635666 2:156293843-156293865 GGATGACAGTGGCGGCTTTGTGG + Intergenic
940643817 2:156369654-156369676 TGATGACAATGGCGGTTTTGTGG + Intergenic
940652146 2:156451130-156451152 TGATGACAATGGCGGTTTTGTGG - Intronic
940899995 2:159117850-159117872 TGATGACCTTGGCAGTTTTGGGG + Intronic
941023799 2:160438726-160438748 TGATGACAATGGCGGTTTTGTGG - Intronic
941197684 2:162470773-162470795 TGATGACAATGGTGGTTTTGTGG + Intronic
941543191 2:166812677-166812699 TGATGACCTTGACAGTTTTGAGG - Intergenic
941602800 2:167563116-167563138 TGATGACAATGGCGGTTTTGTGG - Intergenic
941739931 2:169024775-169024797 TAATGACCTTGGCAGTTTTGAGG + Intronic
941774064 2:169372750-169372772 TGATGACCTTGACAGTTTTGAGG + Intergenic
941786856 2:169506329-169506351 TGATGACAGTGGCGGCTTTGTGG + Exonic
941793156 2:169574977-169574999 TGATGACAATGGCGGTTTTATGG - Intergenic
941814358 2:169785493-169785515 GGATGACAATGGCGGCTTTGTGG - Intergenic
941847973 2:170150432-170150454 TGATGACAATGGCGGTTTTGTGG + Intergenic
942020801 2:171866299-171866321 TGATGACAATGGCGGTTTTGTGG - Intronic
942024884 2:171900484-171900506 TGATGACAATGGCGGTTTTGTGG + Intronic
942096424 2:172538589-172538611 GGATGACAATGGCGGTTTTGTGG + Intergenic
942355819 2:175108704-175108726 TGATGACGATGGCGGTTTTGCGG + Intronic
942620951 2:177845005-177845027 GGATGACAATGGCGGCTTTGTGG - Intronic
942630875 2:177947294-177947316 GGATGACAATGGCGGCTTTGTGG + Intronic
942754020 2:179319421-179319443 TGATGACAATGGTGGTTTTGTGG - Intergenic
943297028 2:186153797-186153819 GGATGACAATGGCAGCTTTGTGG - Intergenic
943318673 2:186419154-186419176 TGATGTCTATTGCAGTTTTGAGG - Intergenic
943323722 2:186473723-186473745 TGATGACAATGGCAGTTTTGTGG + Intergenic
943412016 2:187557438-187557460 TGATGACAATGGCGGTTTTGTGG + Intronic
943553021 2:189364789-189364811 TGATGACGTTGGCAGTTTTGAGG - Intergenic
943648230 2:190430672-190430694 TGATGACAATGGCGGTTTTGTGG - Intronic
943739697 2:191397659-191397681 TGATGACAATGGCGGTTTTGTGG - Intronic
943773790 2:191742938-191742960 TGATGACGATGGCGGTTTTCTGG + Intergenic
944061012 2:195568703-195568725 GGATGACAATGGCGGCTTTGTGG + Intergenic
944283208 2:197922479-197922501 GGATGACAATGGCGGCTTTGTGG - Intronic
944532699 2:200683093-200683115 TGATGACAATGGCGGTTTTGTGG - Intergenic
944570963 2:201042962-201042984 TGATGACAATGGCGGTTTTGTGG + Intronic
944585042 2:201166046-201166068 TGATGACGATGGCGGTTTTGTGG - Exonic
944593391 2:201239234-201239256 TGATGACAATGGCGGTTTTGTGG - Intronic
944598264 2:201282403-201282425 TGATGACAATGGCGGTTTTGTGG - Intronic
944625174 2:201562982-201563004 GGATGACAATGGCGGCTTTGTGG - Intronic
944732827 2:202534727-202534749 GGATGACAATGGCGGCTTTGTGG - Intronic
944737225 2:202578014-202578036 GGATGACAATGGCGGCCTTGTGG + Intergenic
944751452 2:202714999-202715021 TGATGACAATGGCAGTTTTGTGG - Intronic
944798033 2:203207439-203207461 TGATGACAATGGCGGTTTTGTGG + Intronic
944815471 2:203372395-203372417 GGATGACAATGGCGGTTTTGTGG - Intronic
945090229 2:206171430-206171452 TGATGACGACGGCGGTTTTCTGG - Intergenic
945110239 2:206356016-206356038 TGATGACAATGGCGGTTTTGTGG - Intergenic
945114757 2:206400476-206400498 GGATGACAATGGCTGCTTTGTGG - Intergenic
945211439 2:207387182-207387204 TGATGACACTGTCGGTTTTTTGG - Intergenic
945233342 2:207611547-207611569 CGATGACAATGGCGGTTTTGTGG + Exonic
945835487 2:214834764-214834786 TGATGACAATGGCGGTTTTGTGG - Intergenic
945970003 2:216225708-216225730 TGATGACAATGGCGGTTTTGTGG - Intergenic
946240059 2:218348735-218348757 TGATGACGATGGTGGTTTTGTGG - Intergenic
946304353 2:218847105-218847127 GGATGACAATGGCGGCTTTGTGG + Intergenic
946651065 2:221892560-221892582 TGATGACAATGGCGGTTTTGTGG + Intergenic
946742905 2:222817120-222817142 GGATGACAATGGCGGCTTTGTGG + Intergenic
946750944 2:222895946-222895968 TGATGACAATGGCGGTTTTGTGG - Intronic
947072065 2:226299958-226299980 TGATGACCTTGACAGTTTTGAGG - Intergenic
947383022 2:229563541-229563563 TGATGACGATGATGGTGATGGGG - Intronic
947383202 2:229564638-229564660 TGATGATGATGGTGGTGATGGGG - Intronic
947402645 2:229743665-229743687 TGATGACAATGGCAGTTTTGTGG + Intergenic
947647216 2:231751613-231751635 TGATGACCTTGACAGTTTTGAGG + Intronic
947798161 2:232906709-232906731 TGATGACAATGGCGGTTTTGTGG + Intronic
947901233 2:233723997-233724019 GGATGACAATGGCGGCTTTGTGG - Intronic
948000521 2:234563142-234563164 TGATGACAATGGCGGTTTTGTGG + Intergenic
948651583 2:239449395-239449417 TGATGACAATGGCGGTTTTGTGG - Intergenic
948706486 2:239796145-239796167 TGATGACAATGGCGGTTTTGTGG + Intronic
1168923636 20:1561541-1561563 TGATGACCTTGACAGTTTTGAGG + Intronic
1169086246 20:2825269-2825291 TGATGACAATGGCGGTTTTGTGG + Intergenic
1169108615 20:3018691-3018713 TGATGACAATGGCGGTTTTGTGG - Intronic
1169167947 20:3440899-3440921 TGATGACAATGGCGGTTTTGTGG - Intergenic
1169247286 20:4033602-4033624 TGATGACAATGGCGGTTTTGTGG + Intergenic
1169371043 20:5028181-5028203 GGATGACAATGGCGGCTTTGTGG + Intergenic
1169449942 20:5702251-5702273 TGATGACAATGGCGGTTTTGTGG + Intergenic
1169718378 20:8644855-8644877 GGATGACAATGGCGGTTTTGTGG + Intronic
1169808321 20:9582328-9582350 TGATGACCTTGACAGTTTTGAGG + Intronic
1169885526 20:10394768-10394790 TGATGACGATGGTGGTTTTGTGG - Intergenic
1169991843 20:11513274-11513296 TGATGACGATGGCGGTTTTGTGG - Intergenic
1170202658 20:13760908-13760930 TGATGACAATGGCGGTTTTGTGG + Intronic
1170384454 20:15800716-15800738 TGATGACAATGGCGGTTTTGTGG + Intronic
1170424665 20:16227004-16227026 GGATGACAATGGTGGCTTTGTGG - Intergenic
1170479500 20:16752007-16752029 TGAGGAGGATGCAGGTTTTGTGG + Exonic
1170622870 20:18010056-18010078 GGATGACAATGGCGGCTTTGTGG - Intronic
1170645823 20:18194903-18194925 TGATGACGACGGCGGTTTTGTGG + Intergenic
1170677388 20:18495115-18495137 TGATGACAATGGCAGTTTTGTGG + Intronic
1170811409 20:19678174-19678196 GGATGACAATGGCGGTTTTGTGG - Intronic
1171131266 20:22655419-22655441 TGACTACTATGGTGGTTTTGAGG + Intergenic
1171253732 20:23670129-23670151 TGGTGATGATGACGGTATTGTGG - Intergenic
1171365963 20:24625830-24625852 TGATGACAATGGCGGTTTTGTGG - Intronic
1171497025 20:25562322-25562344 TGATGACAATGGCGGTTTTGTGG + Intronic
1171848323 20:30291449-30291471 TGATGACAATGGCAGTTTTGTGG - Intergenic
1171861687 20:30406130-30406152 TGATGACAATGGCGGTTTTGTGG + Intergenic
1171899763 20:30846812-30846834 TGATGACAATGGCGGTTTTGTGG - Intergenic
1171951984 20:31427948-31427970 GGATGACAATGGCGGTTTTGTGG + Intergenic
1171956774 20:31469915-31469937 GGATGACAATGGCGGTTTTGTGG - Intronic
1172051324 20:32121669-32121691 GGATGACAGTGGCGGCTTTGTGG - Intronic
1172059598 20:32177449-32177471 GGATGACAATGGCGGCTTTGTGG + Intergenic
1172141393 20:32724468-32724490 GGATGACAATGGCGGCTTTGTGG + Intronic
1172199707 20:33115988-33116010 GGATGACAATGGCGGTTTTGTGG + Intergenic
1172209038 20:33184979-33185001 TGATGACAATGGCGGTTTTGTGG - Intergenic
1172257916 20:33536136-33536158 GGATGACAATGGCGGTTTTGTGG - Intronic
1172279701 20:33700234-33700256 TGATGACAATGGCGGTTTTGTGG + Intergenic
1172280087 20:33701845-33701867 TGATGACAATGGTGGTTTTGTGG + Intergenic
1172348675 20:34223746-34223768 GGATGACAATGGCGGCTTTGTGG + Intronic
1172349184 20:34229051-34229073 GGATGACAATGGCGGCTTTGTGG - Intronic
1172379165 20:34474630-34474652 TGATGACAATGGCGGTTTTGTGG - Intronic
1172402273 20:34659579-34659601 GGATGACAATGGCGGTTTTGTGG + Intronic
1172465949 20:35154575-35154597 GGATGACAATGGCAGCTTTGTGG + Intergenic
1172574894 20:36001204-36001226 TGATGACAATGGCGGTTTTGTGG - Intronic
1172576858 20:36016189-36016211 TGATGACCTTGGCAGTTTTGAGG - Intronic
1172717478 20:36976194-36976216 TGATGACAATGGCGGTTTTGTGG - Intergenic
1172721387 20:37001288-37001310 TGATGACAATGGCGGTTTTGTGG + Intronic
1172722974 20:37013115-37013137 TGATGAGAATGGCGGTTTTGTGG + Intronic
1172729024 20:37069997-37070019 GGATGACAATGGCGGCTTTGTGG + Intronic
1172736086 20:37126662-37126684 GGATGACAATGGCGGTTTTGTGG + Intronic
1172763568 20:37338600-37338622 TGATGACCCTGACAGTTTTGAGG + Intergenic
1172819258 20:37718074-37718096 TGATGACAATGGCGGTTTTGTGG - Intronic
1172897957 20:38313889-38313911 TGATGATGATGGTGATTCTGAGG + Intronic
1172907453 20:38379459-38379481 TGATGACAATGGCGGTTTTGTGG + Intergenic
1172918309 20:38461112-38461134 TGATGACAATGGCGGTTTTGTGG - Intergenic
1173272913 20:41554847-41554869 TGATGACAATGGCGGTTTTGTGG - Intronic
1173472340 20:43333385-43333407 TGATGACAATGGTGGTTTTGTGG + Intergenic
1173508320 20:43607050-43607072 TGATGACAATGGCGGTTTTGTGG - Intronic
1173517882 20:43677832-43677854 TGATGACAATGGCAGTTTTGTGG + Intronic
1173769399 20:45645487-45645509 TGACGACAATGGCGGTTTTGTGG - Intergenic
1174020405 20:47525400-47525422 TGATGACAATGGCGGTTTTGTGG - Intronic
1174218515 20:48935560-48935582 TGATGACAGTGGCGGTTTTGTGG - Intronic
1174345018 20:49922647-49922669 TGATGACAATGGCGGTTTTGTGG + Intergenic
1174371073 20:50088167-50088189 TGATGCCCTTGGCTGTTTTGAGG - Intronic
1174397281 20:50254915-50254937 TGATGACCTTGACGGTTTTGAGG + Intergenic
1174835894 20:53854748-53854770 TGATGACAATGGTGGTTTTGTGG + Intergenic
1174878201 20:54250224-54250246 TGATGACAATGGCGGTTTTGTGG - Intergenic
1175361107 20:58413612-58413634 GGATGACAATGGCGGCTTTGTGG - Intronic
1175389126 20:58615364-58615386 AAATGACGATGGCTGTTGTGAGG - Intergenic
1175543367 20:59762165-59762187 TGGTGAGGATGGATGTTTTGGGG + Intronic
1175677112 20:60956392-60956414 TGATGACCCTGGCAGTTTTGAGG + Intergenic
1175775840 20:61653403-61653425 TGATGACAATGGCGGTTTTGTGG - Intronic
1175955748 20:62608245-62608267 TCATGACCTTGGCGGTTTTGAGG - Intergenic
1176348138 21:5770273-5770295 TGATGACAATGGCGGTTTTGTGG - Intergenic
1176354952 21:5890857-5890879 TGATGACAATGGCGGTTTTGTGG - Intergenic
1176496689 21:7554182-7554204 TGATGACAATGGCGGTTTTGTGG + Intergenic
1176542459 21:8168343-8168365 TGATGACAATGGCGGTTTTGTGG - Intergenic
1176561410 21:8351388-8351410 TGATGACAATGGCGGTTTTGTGG - Intergenic
1176656622 21:9593577-9593599 TGATGACAATCGCGGTTTTGTGG - Intergenic
1176719021 21:10378554-10378576 GGATGACACTGGTGGTTTTGCGG - Intergenic
1177134072 21:17291977-17291999 GGATGACAATGGCGGCTTTGTGG - Intergenic
1177177861 21:17719111-17719133 GGATGACAATGGCGGCTTTGTGG - Intergenic
1178034496 21:28564316-28564338 GGATGACAATGGCGGTTTTGTGG + Intergenic
1178075873 21:29012300-29012322 TGATGACAATGGCGGTTTTGTGG + Intronic
1178318148 21:31584372-31584394 TGATGATAATGGCGGTTTTGTGG - Intergenic
1178377725 21:32081778-32081800 TGATGACCTTGACCGTTTTGAGG + Intergenic
1178812743 21:35898136-35898158 TGATGACAATGGCGGTTTTGTGG + Intronic
1179195340 21:39157729-39157751 TGATGACGATGGCGGTTTTCTGG + Intergenic
1179646425 21:42778752-42778774 TGATGACAATGGCGGTTTTGTGG + Intergenic
1179969410 21:44825463-44825485 TGATGACAATGGCGGTTTTGTGG + Intergenic
1180039711 21:45269315-45269337 GGATGACAATGGCGGCTTTGTGG + Intronic
1180125262 21:45785661-45785683 TGATGACAGTGGTGGTTTTGTGG + Intronic
1180300253 22:11031536-11031558 GGATGACACTGGTGGTTTTGCGG - Intergenic
1180672176 22:17561558-17561580 TGATGACAGTGGCAGTTTTGTGG + Intergenic
1180739175 22:18041380-18041402 TGATGACAATGGCGGTTTTGTGG - Intergenic
1180829931 22:18900164-18900186 TGATGACAATGGCGGTTTTGTGG - Intergenic
1180861471 22:19084957-19084979 TGATGACAATGGTGGTTTTGTGG + Intronic
1181301302 22:21883405-21883427 TGATGACAATGGCAGTTTTGTGG - Intergenic
1181374182 22:22442148-22442170 TGATGACAATGGCGGTTTTGTGG + Intergenic
1181538546 22:23560944-23560966 TGATGACAATGGTGGTTTTGTGG - Intergenic
1181586626 22:23855811-23855833 TGATGACAATGGCGGTTTTGTGG + Intergenic
1181598971 22:23937421-23937443 GGATGACAATGGCGGCTTTGTGG + Intergenic
1181617473 22:24064983-24065005 TGATGACAATGGCAGTTTCGTGG - Intronic
1181657616 22:24316745-24316767 TGATGACAATGGTGGTTTTGTGG - Intronic
1181792236 22:25277600-25277622 TGATGACAATGGCGGTTTTGTGG - Intergenic
1181981838 22:26772615-26772637 GGATGACAATGGCGGCTTTGTGG - Intergenic
1182099094 22:27645432-27645454 TGGTGATGATGGTGGTTGTGGGG - Intergenic
1182199493 22:28553901-28553923 TGATGACAGTGGCAGTTTTGTGG + Intronic
1182343483 22:29643757-29643779 GGATGACAATGGCGGCTTTGTGG - Intronic
1182377203 22:29857716-29857738 TGATGACAATGGCGGTTTTGTGG - Intergenic
1182399014 22:30059984-30060006 TGATGATGATGGCGGTTTTGTGG + Intergenic
1182399897 22:30067040-30067062 TGATGATGATGGCGGTTTTGTGG + Intergenic
1182484471 22:30631470-30631492 TGATGACAATGGCGGTTTTGTGG - Intergenic
1182539230 22:31027877-31027899 TGATGACAATGGCGGTTTTGTGG + Intergenic
1182616079 22:31591434-31591456 GGATGACAATGGCGGCTTTGTGG - Intronic
1182976120 22:34625742-34625764 GGATGACAATGGCGGTTTTGTGG - Intergenic
1182982322 22:34684157-34684179 TGATGACAATGGCGGTTTTGTGG - Intergenic
1183092690 22:35533770-35533792 TGATGACGATAGCGATGATGGGG + Intergenic
1183185880 22:36291207-36291229 TGATGACAATGGCGGTTTTGTGG + Intronic
1183434807 22:37787127-37787149 TGATGACAATGGCGGTTTTGTGG + Intergenic
1183595612 22:38808066-38808088 GGATGACAATGGCGGCTTTGTGG + Intergenic
1183840949 22:40500860-40500882 GGATGACAATGGCGGCTTTGTGG - Intronic
1183845714 22:40538095-40538117 GGATGACAATGGCGGCTTTGTGG + Intronic
1183871317 22:40744620-40744642 TGATGACAATGGCGGTTTTGTGG - Intergenic
1183941108 22:41295226-41295248 GGATGACAATGGCGGCTTTGTGG + Intergenic
1183995579 22:41630929-41630951 TGATGACAATGGTGGTTTTGTGG - Intronic
1184169410 22:42750418-42750440 GGATGACAATGGCGGCTTTGTGG - Intergenic
1184203082 22:42982402-42982424 TGATGACAATGGCGGTTTTGTGG + Intronic
1184283646 22:43453529-43453551 TGATGATGATGGGGGTGTGGGGG + Intronic
1185064476 22:48624111-48624133 TGATGACCCTGACAGTTTTGAGG + Intronic
1203247398 22_KI270733v1_random:84761-84783 TGATGACAATGGCGGTTTTGTGG - Intergenic
1203280022 22_KI270734v1_random:125435-125457 TGATGACAATGGCGGTTTTGTGG - Intergenic
949551088 3:5113678-5113700 TGATGACAATGGCGGTTTTGTGG - Intergenic
949569901 3:5283689-5283711 TGATGACAATGGTGGTTTTGTGG - Intergenic
949648717 3:6129587-6129609 TGATGACAATGGCGGTTTTGTGG - Intergenic
949697868 3:6720185-6720207 TGATGACCTTGACAGTTTTGAGG - Intergenic
949853661 3:8440750-8440772 TGATGACAATGGCGGTTTTGTGG + Intergenic
949989942 3:9570264-9570286 TGATGACGATGGCAGTTTTGTGG + Intergenic
949992731 3:9592272-9592294 TGACGACAATGGCAGTTTTGTGG + Intergenic
950044210 3:9939799-9939821 GGATGACAATGGCGGTTTTGTGG - Intronic
950060980 3:10070656-10070678 GGATGACAATGGCGGTTTTGTGG + Intronic
950253538 3:11487301-11487323 GGATGACAATGGCGGCTTTGTGG - Intronic
950412629 3:12849494-12849516 TGATGACAATGGCGGTTTTGTGG - Intronic
950742643 3:15062596-15062618 TGATGACAATGGCAGTTTTGTGG + Intronic
950754564 3:15162498-15162520 TGATGACAATGGCGGTTTTGTGG - Intergenic
950819657 3:15742903-15742925 TGATGACAATGGTGGTTTTGTGG + Intronic
950948967 3:16979804-16979826 TGATGACAATGGCGGTTTTGTGG - Intronic
951013171 3:17704388-17704410 GGATGACAATGGCTGCTTTGTGG - Intronic
951290332 3:20866624-20866646 TGATGACAATGGCGGTTTTGTGG - Intergenic
951550377 3:23871144-23871166 TGATGACAATGGCGGTTTTGTGG - Intronic
951635466 3:24770103-24770125 TGATGACCTTGACAGTTTTGAGG - Intergenic
952269769 3:31819240-31819262 GGGTGACGATGGCAGCTTTGAGG + Intronic
952280861 3:31922019-31922041 TGATGACCTTGACAGTTTTGAGG - Intronic
952308991 3:32170126-32170148 TGATGACAATGGCGGTTTTGTGG + Intergenic
952364769 3:32664412-32664434 TGATGACAATGGCGGTTTTGTGG + Intergenic
952689058 3:36182221-36182243 TGATGACGTTGGCAGTTTTGAGG + Intergenic
952703787 3:36355084-36355106 TGATGTCCTTGACGGTTTTGAGG + Intergenic
952896277 3:38081282-38081304 GGATGACAATGGCTGCTTTGTGG - Intronic
952934832 3:38389411-38389433 TGATGACGATGGCGGTTTTGTGG - Intronic
953037900 3:39228124-39228146 TGATGACAATGGCGGTTTTGTGG + Intergenic
953257852 3:41306674-41306696 TGATGACAATGGCGGTTTTGTGG + Intronic
953426455 3:42798815-42798837 GGATGACAATGGCGGCTTTGTGG + Intronic
953652545 3:44820817-44820839 TGATGACAATGGCGGTTTTGTGG - Intronic
953855313 3:46495209-46495231 GGATGACAATCGCGGCTTTGTGG + Intergenic
953895781 3:46799133-46799155 TGATGACTTTGACAGTTTTGAGG - Intronic
953922917 3:46964479-46964501 TGATGACAATGGCGGTTTTGAGG + Intronic
953959595 3:47256670-47256692 TGATGACAGTGGCAGTTTTGTGG + Intronic
954048454 3:47952415-47952437 TGATGACAATGGCGGTTTTGTGG + Intronic
954056718 3:48032086-48032108 TGATGACTTTGACAGTTTTGAGG - Intronic
954059784 3:48057137-48057159 GGATGACAATGGCGGCTTTGTGG + Intronic
954081188 3:48212607-48212629 GGATGACAATGGCGGCTTTGTGG + Intergenic
954118880 3:48483555-48483577 AGGTGACAATGGCGGTTTTGTGG - Intronic
954163007 3:48734965-48734987 TGATGACAATGGCGGTTTTGTGG + Intronic
954399136 3:50311067-50311089 TGATGACAATGGCGGTTTTGTGG - Intronic
954483440 3:50823632-50823654 GGATGACAATGGCGGTTTTGTGG - Intronic
954523672 3:51249802-51249824 GGATGACAATGGCGGCTTTGTGG + Intronic
954529740 3:51308685-51308707 TGATGACAATGGCGGTTTTGTGG - Intronic
954599933 3:51859179-51859201 TGATGACAATGGCGGTTTTGTGG + Intergenic
955172810 3:56583764-56583786 TGATGACGATGGCGGTTTTGTGG - Intronic
955297701 3:57748286-57748308 GGATGACAAGGGCGGCTTTGCGG + Intergenic
955362754 3:58289702-58289724 TGATGACAATGGTGGTTTTGTGG - Intronic
955394595 3:58549537-58549559 GGATGACAATGGCGGCTTTGTGG - Intergenic
955434694 3:58890019-58890041 GGATGACAATGGCGGCTTTGTGG - Intronic
955674282 3:61434260-61434282 GGATGACAGTGGCGGCTTTGTGG - Intergenic
955699685 3:61671606-61671628 TGATGACAATGGCGGTTTTGTGG - Intronic
955869267 3:63419284-63419306 TGATGGCTATAGCAGTTTTGAGG - Intronic
956270862 3:67445146-67445168 GGATGACAATGGCGGCTTTGTGG + Intronic
956365435 3:68496898-68496920 TGATGATGATGATGGTGTTGTGG - Intronic
956376001 3:68614277-68614299 TGATGACCTTGGCAGTTTTGAGG - Intergenic
956697264 3:71929073-71929095 TGATGACAATGGCGTTTTTGTGG + Intergenic
957035649 3:75289990-75290012 TGATGACAATGGCGGTTTTGTGG + Intergenic
957203466 3:77165089-77165111 GGATGACAATGGCGGTTTTGTGG + Intronic
957620366 3:82585219-82585241 TGATGACAATGGCGGTTTCGTGG + Intergenic
957783122 3:84845428-84845450 TGATGACGCTGGCTGTCATGTGG + Intergenic
957789351 3:84919047-84919069 TGATGACGATGGCGGTTTTGTGG + Intergenic
958560704 3:95744629-95744651 TGATGACAATGGCGGTTTTGTGG - Intergenic
958808182 3:98836560-98836582 GGATGACAATGGCGGCTTTGTGG - Intronic
958957165 3:100477375-100477397 TGATGACAATGGCGGTTTTGTGG - Intergenic
959042936 3:101440099-101440121 GGATGACAATGGCGGCTTTGTGG + Intronic
959201594 3:103254791-103254813 TGATGACAATGGTGGTTTTGTGG - Intergenic
959221865 3:103531378-103531400 TGATGACAGTGGCGGTTTTGTGG - Intergenic
959291025 3:104474763-104474785 TGATGACAATGGTGGTGTGGCGG - Intergenic
959348534 3:105231106-105231128 TTATGACCATGACAGTTTTGAGG + Intergenic
959415026 3:106073285-106073307 TGATGACAATGGCGGTTTTGTGG - Intergenic
959418997 3:106110999-106111021 GGATGACAATGGCGGTTTTGTGG - Intergenic
959586017 3:108026132-108026154 TGATGACAATGGCGGTTTTGTGG - Intergenic
959683963 3:109124657-109124679 GGATGACAATGGCGGTTTTGTGG + Intergenic
959984366 3:112556553-112556575 TGATGACAATGGCGGTTTTGTGG + Intronic
960029851 3:113046109-113046131 TGATGACAATGGCGGTTTTGTGG - Intergenic
960111449 3:113849759-113849781 TCATGACAATGGCGGTTTTGTGG - Intronic
960388737 3:117051006-117051028 TGATGACAATGGCGGTTTTGTGG + Intronic
960439435 3:117668788-117668810 TGATGACCTTGACAGTTTTGAGG - Intergenic
960526546 3:118718216-118718238 GGATGACAATGGCGGTTTTGTGG - Intergenic
960551000 3:118976434-118976456 CAATGATGATGGTGGTTTTGGGG - Intronic
960698060 3:120414518-120414540 GGATGACAATGGCGGCTTTGTGG + Intronic
960780276 3:121312927-121312949 TGATGACAATGGCGGTTTTGTGG - Intronic
960817640 3:121689178-121689200 TGATGACAATGGCGGTTTTGTGG + Intronic
960862384 3:122165431-122165453 GGATGACAATGGCGGCTTTGTGG + Intergenic
960866006 3:122201467-122201489 TGATGACAATGGCAGTTTTGTGG - Intronic
960921184 3:122747909-122747931 TGATGACAATGGCGGTTTTGTGG + Intronic
960924087 3:122779974-122779996 TGATGACAATGGCGGTTTTGTGG - Intronic
961120069 3:124366671-124366693 GGATGACAATGGCGGTTTTGTGG - Intronic
961163599 3:124749860-124749882 TGATGACAATGGCAATTTTGTGG - Intergenic
961604061 3:128080662-128080684 TGATGACCCTGACAGTTTTGAGG - Intronic
961729760 3:128955702-128955724 GGATGACAATGGCGGCTTTGTGG + Intronic
961784052 3:129338926-129338948 TGATGACAATGGCGGTTTTGTGG - Intergenic
961788565 3:129362166-129362188 TGATGACAATGGCGGTTTTGTGG - Intergenic
961962766 3:130868953-130868975 TGATGACAATGGCGGTTTTGTGG + Intronic
962063349 3:131952769-131952791 GGATGACCATGGCGGTTTTGTGG + Intronic
962112652 3:132470453-132470475 GGATGACAATGGCGGCTTTGTGG - Intronic
962245319 3:133785740-133785762 GGATGACAATGGCGGCCTTGTGG + Intronic
962572436 3:136724130-136724152 TGATGACAATGGCGGTTTTGTGG + Intronic
962622989 3:137198329-137198351 TGATGACAATGGCGGTTTTGTGG - Intergenic
962790863 3:138810598-138810620 TGATGACCATGACAGTTCTGAGG - Intronic
963244338 3:143046785-143046807 TGATGACAATGGCGGTTTTGTGG - Intronic
963247169 3:143073905-143073927 TGATGACGATGGTGGTTTTGTGG + Intergenic
963248806 3:143086082-143086104 TGATGACAATGGCGGTTTTGTGG - Intergenic
963451085 3:145482718-145482740 TGATGACAATGGCGGTTTTGTGG - Intergenic
963498637 3:146097326-146097348 TGATGACAATGGCGGTTTTGTGG + Intronic
963770406 3:149380927-149380949 GGATGACAATCGCGGCTTTGTGG + Intergenic
963911105 3:150819869-150819891 TGATGACAATGGCGGTTTTGTGG - Intergenic
964766077 3:160179110-160179132 TGATGACCATGGCGGTTTTGTGG + Intergenic
964874513 3:161351020-161351042 TGATGACCTTGGGGGTTTTGGGG - Intronic
966015003 3:175131609-175131631 GGATGACAATGGCGGTTTTGTGG - Intronic
966253364 3:177891545-177891567 TGATGACAATGGCAGTTTTGTGG - Intergenic
966360270 3:179121608-179121630 GGATGACAATGGCGGCTTTGTGG + Intergenic
966375308 3:179290764-179290786 GGATGACAATGGCGGCTTTGTGG - Intergenic
966419977 3:179727633-179727655 TGATGACAATGGCGGTTTTGTGG - Intronic
966784359 3:183609299-183609321 TGATGACAATGGCGGTTTTGTGG + Intergenic
966966891 3:185003620-185003642 TGATGACAATGGCGGTTTTGTGG - Intronic
967133322 3:186492690-186492712 TGATGATGCTGGCTGTTTTCAGG + Intergenic
967169242 3:186811335-186811357 TGATGACAGTGGCGGTTTTGTGG - Intergenic
967176405 3:186865107-186865129 TGATGACAATGGCGGTTTTGTGG + Intergenic
967177719 3:186874590-186874612 TGATGACAATGGCGGTTTTGTGG + Intergenic
967178641 3:186884767-186884789 TGATGACAATGGCGGTTTTGTGG - Intergenic
967289145 3:187902302-187902324 TGGTGAGGATGGCCGTTGTGAGG - Intergenic
967524363 3:190473727-190473749 TGATGACAATGGCGGTTTTGTGG + Intergenic
967896623 3:194400701-194400723 TGATGACAATGGCAGTTTTGTGG + Intergenic
968042381 3:195599605-195599627 TGATGATGATGGCGGTTTTGTGG - Intergenic
968175113 3:196543049-196543071 TGATGACAATGGCGGTTTTGTGG - Intergenic
968201718 3:196761623-196761645 GGATGACAATGGCGGCTTTGTGG - Intronic
968226215 3:196973855-196973877 TGATGACAATGGCGGTTTTGTGG + Intergenic
968299461 3:197602202-197602224 TGATGACAATGGCGGTTTTGTGG - Intergenic
968411870 4:396298-396320 TGATGACAATGGCGGTTTTGTGG + Intergenic
968429766 4:550309-550331 TGATGGCAATGGCGGTTTTGTGG - Intergenic
968436405 4:592468-592490 TGATGACAGTGGCGGTTTTGTGG + Intergenic
968507243 4:976392-976414 TGATGACAATGGCGGTTTTGTGG + Intronic
968666927 4:1827755-1827777 GGATGACAATGGCGGCTTTGTGG - Intronic
968688848 4:1979386-1979408 TGATCACAATGGCAGTTTCGAGG - Exonic
968924055 4:3538315-3538337 TGATGACAATGGCGGTTTTGTGG - Intergenic
969110153 4:4839405-4839427 TGATGTGGGTGGCGGGTTTGAGG + Intergenic
969374870 4:6756186-6756208 TGATGACAATGGCGGTTTTGTGG + Intergenic
969404283 4:6978268-6978290 TGATGACAATGGCGGTTTTGTGG + Intronic
969573446 4:8023369-8023391 TGAGGACTCTGGCAGTTTTGAGG + Intronic
970215965 4:13760936-13760958 TGATGACAATGGCGGTTTTGTGG - Intergenic
970409665 4:15791952-15791974 TGATGACAATGGCGGTTTTGTGG + Intronic
970472515 4:16392998-16393020 TGATGACAATGGTGGTTTTGTGG - Intergenic
970980552 4:22091721-22091743 TGATGATGATGGTGGTAGTGTGG - Intergenic
971594722 4:28514661-28514683 TGATGACAATGGCGGTTTTGTGG - Intergenic
971773301 4:30927384-30927406 TGATGACAATGGCGGTTTTGTGG + Intronic
972141331 4:35963512-35963534 TTATGACGTTGGCAGTTTTGAGG - Intronic
972288515 4:37669560-37669582 TGATGACAATGGCAGTTTTGTGG + Intronic
972412627 4:38808207-38808229 TGATGACAATGGCGGTTTTGTGG + Intronic
972551686 4:40141056-40141078 TGATGACAATGGCGGTTTTGTGG - Intronic
972552507 4:40147379-40147401 TGATGACAATGGCGGTTTTGTGG - Intronic
972939862 4:44182317-44182339 TGATGAAGATGGCGGTTTTGTGG + Intronic
973109355 4:46378186-46378208 TGATGACAATGGCGGTTTTGTGG + Intronic
973281169 4:48363228-48363250 GGATGACAATGGCGGCTTTGTGG - Intronic
973593928 4:52466114-52466136 GGATGACAATGGCGGCTTTGTGG + Intergenic
973672642 4:53237306-53237328 GGATGACAATGGCGGCTTTGTGG - Intronic
973675059 4:53255679-53255701 TGATGACAATGGAGGTTTTGTGG - Intronic
973784875 4:54325260-54325282 GGATGACAATCGCGGCTTTGTGG - Intergenic
974021119 4:56693324-56693346 TGATGACAATGGCGGTTTTGTGG - Intergenic
974076710 4:57173615-57173637 TGATGACAATGGCAGCTTTGTGG + Intergenic
974082249 4:57224709-57224731 TGATGACAATGGCGGTTTTGTGG + Intergenic
974588804 4:63918412-63918434 GGATGACAATGGCGGCTTTGTGG - Intergenic
974661845 4:64900349-64900371 GGATGACAATGGCGGTTTTGTGG + Intergenic
975042607 4:69762515-69762537 TGATGACAATGGCAGTTTTGTGG + Intronic
975633567 4:76423806-76423828 TGATGACAATGGTGGTTTTGTGG + Intergenic
975686242 4:76918391-76918413 TGATGACAATGGCGGTTTTGTGG + Intergenic
975793563 4:77983633-77983655 TGATGACAAGGGCAGTTTTGTGG - Intergenic
975848550 4:78548579-78548601 TGATGACAATGGCGGTTTTGTGG + Intergenic
976265324 4:83182888-83182910 GGATGACAATGGCGGTTTTGTGG + Intergenic
976265517 4:83185072-83185094 TGATGACAATGGTGGTTTTGTGG - Intergenic
976340654 4:83943296-83943318 TGATGACAATGGTGGTTTTGTGG - Intergenic
976607478 4:86996252-86996274 TGATGACAATGGCGGTTTTGTGG + Intronic
977205223 4:94158374-94158396 GGATGACAATGGCGGCTTTGTGG + Intergenic
978123758 4:105110768-105110790 TGATGACAATGGCGGTTTTGTGG + Intergenic
978409325 4:108410097-108410119 TGATGACAATGGCGGTTTTGTGG + Intergenic
978746491 4:112200699-112200721 TGATGACCTTGAAGGTTTTGAGG - Intergenic
978820137 4:112957481-112957503 TGATGACAATGGTGGTTTTGTGG - Intronic
978947623 4:114516930-114516952 TGATGAGAATGGCGGTTTTGTGG + Intergenic
979622656 4:122812722-122812744 TGATGACAATGGCGGTTTTGTGG + Intergenic
979641355 4:123015651-123015673 TGATGACAATGGCGGTTTTGTGG - Intronic
980056300 4:128083283-128083305 GGATGACAATGGCGGTTTTGTGG - Intronic
980895370 4:138854793-138854815 GGATGACAATGGCAGCTTTGTGG + Intergenic
981523915 4:145693499-145693521 GGATGACAATGGCGGCTTTGTGG - Intronic
981677631 4:147358438-147358460 TGATGACAATGGCGGCTTTGTGG + Intergenic
981970877 4:150660596-150660618 GGATGACAATGGCGGCCTTGTGG + Intronic
982022044 4:151214335-151214357 TGATGACAATGGTGGTTTTGTGG - Intronic
982025994 4:151254788-151254810 GGATGACAATGGCGGCTTTGTGG - Intronic
982040545 4:151391320-151391342 TGATGACAATGGCGGTTTTGTGG + Intergenic
982053423 4:151526224-151526246 TGATGACAATGGCGGTTTTGTGG - Intronic
982075465 4:151732249-151732271 TGATGACGATGGCGGTTTTGTGG + Intronic
982191922 4:152866335-152866357 TGATGACAATGGCGGTTTTGTGG - Intronic
982615566 4:157636291-157636313 GGATGACAATGGTGGCTTTGTGG - Intergenic
982709522 4:158746252-158746274 TGATGACAATGGTGGTTTTGTGG - Intergenic
982784849 4:159524802-159524824 TGATGACAATGGTGGTTTTGTGG + Intergenic
982820499 4:159938827-159938849 TGATGACAATGGTGGTTTTGTGG - Intergenic
983190246 4:164747217-164747239 GGATGACAATGGCGGCTTTGTGG - Intergenic
983217961 4:165019676-165019698 TGATGACAATGGCGGTTTTGTGG - Intergenic
983604723 4:169570705-169570727 TGATGACAGTGGCGGTTTTGTGG + Intronic
983652456 4:170047092-170047114 TGATGACAATGGCGGTTTTGTGG + Intergenic
983926183 4:173405175-173405197 TGATGACTTTGACCGTTTTGAGG + Intronic
984004665 4:174294510-174294532 TGATGACAATGGCGGTTTTGTGG - Intronic
984037994 4:174692467-174692489 TGATGACAATGGCGGTTTTGTGG + Intronic
984533720 4:180945464-180945486 GGATGACAATGGCGGCTTTGTGG + Intergenic
984583852 4:181540718-181540740 TGATGACCTTGGCAGGTTTGAGG - Intergenic
984728041 4:183040585-183040607 TGATGACAATGGCGGTTTTGTGG - Intergenic
984803485 4:183735207-183735229 TGATGACAATGGCGGTTTTGTGG - Intergenic
984977021 4:185240233-185240255 TGATGACAATGGCGGTTTTGTGG - Intronic
985216451 4:187658393-187658415 TGATGACAATGGCGGTTTTGTGG + Intergenic
985247270 4:187991399-187991421 TGATGACCATGGCGGTTTTGTGG - Intergenic
985255723 4:188068251-188068273 GGATGACAATGGCGGCTTTGTGG + Intergenic
985600634 5:828203-828225 TGATGACAATGGCGGTTTTGTGG - Intronic
985649492 5:1100774-1100796 TGACGACTGTGGCAGTTTTGGGG - Intronic
985736691 5:1586831-1586853 TGATGACAATGGCGGTTTTGTGG + Intergenic
985810888 5:2083814-2083836 TGATGACCTTGATGGTTTTGGGG - Intergenic
986063115 5:4210236-4210258 TGATGACCTTGGTTGTTTTGAGG + Intergenic
986111920 5:4727827-4727849 TAATGACCTTGGCAGTTTTGAGG + Intergenic
986350564 5:6875361-6875383 TTGTGACGTTGGCAGTTTTGAGG + Intergenic
986546144 5:8899514-8899536 TGATGACACTGACAGTTTTGAGG - Intergenic
987267830 5:16276645-16276667 GGATGACAATGGCGGCTTTGTGG - Intergenic
987469488 5:18310253-18310275 TGATGACAATGGCGGTTTTGTGG + Intergenic
988239946 5:28596705-28596727 GGATGACAATGGCGGTTTTGTGG - Intergenic
988544562 5:32142978-32143000 TGATGACAAGGGCGGTTTTGTGG + Intronic
988552454 5:32209163-32209185 TGATGACAATGGCGGCTTTGTGG + Intergenic
988760073 5:34305481-34305503 GGATGACAATGGCGGCTTTGTGG - Intergenic
989021330 5:37012932-37012954 TGATGACAATGGCGGTTTTGTGG - Intronic
989048599 5:37296204-37296226 TGATGACAATGGCAGTTTTGTGG + Intronic
989061382 5:37415248-37415270 TGATGACAATGGCGGTTTTGTGG - Intronic
989064744 5:37448835-37448857 TCATGACCATGACAGTTTTGAGG + Intronic
989068075 5:37483567-37483589 TGATGACGATGGCGGTTTTGTGG - Intronic
989075667 5:37562914-37562936 TGATGACAACGGCAGTTTTGTGG - Intronic
989211218 5:38861585-38861607 GGATGACAATGGCGGTTTTGTGG - Intronic
989247793 5:39273170-39273192 TGATGACAATGGCGGTTTTGTGG + Intronic
989252828 5:39334845-39334867 TGATGGCAATGGCAGTTTTGTGG + Intronic
989380008 5:40801303-40801325 TGATGACAATGGCGGTTTTGTGG + Intergenic
989574852 5:42979746-42979768 TGATAACGATGGCGGTTTTGTGG + Intergenic
989575145 5:42980903-42980925 TGATGACAGTGGCGGTTTTGTGG + Intergenic
989587434 5:43086993-43087015 TGATGACAATGGCGGTTTTGTGG - Intronic
989634982 5:43522606-43522628 TGATGACAATGGCGGTTTTGTGG + Intergenic
989640354 5:43578079-43578101 TGATGACAATGGCGGTTTTGTGG - Intergenic
989829029 5:45891140-45891162 TGATGATGATGGTGGTTTTGTGG + Intergenic
989960760 5:50412393-50412415 TTATGACAATGGAGGTTTTTTGG - Intronic
989978082 5:50608651-50608673 TGATGACGATGGTGGTTTTGTGG + Intergenic
990057835 5:51607120-51607142 TGATGACGTTGGTAGTTTTGAGG + Intergenic
990293990 5:54381760-54381782 TGATGACAATGGCGGTTTTGTGG + Intergenic
990426580 5:55695734-55695756 GGATGACAATGGCAGCTTTGTGG - Intronic
990458780 5:56014387-56014409 GGATGACAATGGCGGTTTTGTGG - Intergenic
990461940 5:56038708-56038730 TGATGACAATGGCGGTTTTGTGG - Intergenic
990498700 5:56373003-56373025 TGATGACAGTGGCGGTTTTGTGG + Intergenic
990870932 5:60431009-60431031 TGATGACAATGGCGGTTTTGTGG - Intronic
991073510 5:62513051-62513073 TGATGACGATGGCGGTTTTCTGG - Intronic
991127305 5:63083682-63083704 TGATGACAATGGCGGTTTTGTGG - Intergenic
991221252 5:64222097-64222119 TGATGACCTTGACAGTTTTGAGG + Intronic
991373456 5:65940844-65940866 TGATGACAATGGCGGTTTTGTGG + Intronic
991376884 5:65976983-65977005 TGATGACAATGGCGGTTTTGTGG - Intronic
991597821 5:68323569-68323591 TGATGACAATGGCGGTTTTGTGG - Intergenic
991672510 5:69062730-69062752 TGATGACAATGGCGGTTTTGTGG - Intergenic
991723374 5:69514991-69515013 TGATGACAATGGCGGTTTTGTGG - Intronic
991907060 5:71525101-71525123 TGATGACAATGGCGGTTTTGTGG - Intronic
992290173 5:75271684-75271706 TGATGACAATGGTGGTTTTGTGG + Intergenic
992340590 5:75819238-75819260 TGATGACAATGGTGGTTTTGTGG + Intergenic
992374266 5:76172574-76172596 GGATGACAATGGCGGCTTTGTGG + Intronic
992391572 5:76335888-76335910 TGATGACAATGGCAGTTTTGTGG - Intronic
992443300 5:76813196-76813218 TGATGACAATGGCGGTTTTGTGG + Intergenic
992463448 5:76984310-76984332 TGATGACAATGGCGGTTTTGTGG - Intergenic
992469455 5:77042277-77042299 GGATGACAATGGCGGCTTTGTGG - Intronic
992544154 5:77794777-77794799 GGATGACAATGGCGGCTTTGTGG - Intronic
992574897 5:78097806-78097828 TGATGACAATGGTGGTTTTGTGG + Intronic
992600095 5:78391119-78391141 TGATGACAATGGCGGTTTTGTGG - Intronic
992801949 5:80301862-80301884 TGATGACAATGGCGGTTTTGTGG + Intergenic
992852384 5:80824161-80824183 TGATGACGATGGCGGTTTTGTGG - Intronic
992864511 5:80943802-80943824 GGATGACAATGGCGGTTTTGTGG - Intergenic
992914416 5:81433135-81433157 TGATGACAATGGCGGTTTTGTGG + Intronic
992963944 5:81983020-81983042 TGATGACAATGGCGGTTTTGTGG - Intronic
992978483 5:82140751-82140773 GGATGACAATGGCGGCTTTGTGG + Intronic
993162623 5:84312026-84312048 TGATGACAATGGCGGTTTTGTGG - Intronic
993496743 5:88616343-88616365 TGATGACGATGGCGGTTTTGTGG + Intergenic
993657446 5:90594951-90594973 GGATGACAATGGCGGCTTTGTGG - Intronic
993658599 5:90602591-90602613 TGATGACTTTGGCGCTTTTGAGG - Intronic
995123423 5:108558842-108558864 TGATGACAATGGCAGTTTTGTGG - Intergenic
995193998 5:109343034-109343056 GGATGACAATGGCGGCTTTGTGG + Intronic
995516094 5:112955320-112955342 GGATGACAATGGCGGCTTTGTGG + Intergenic
995772866 5:115690772-115690794 TGATGACAATGGCGGTTTTGTGG + Intergenic
995807646 5:116071406-116071428 TGATGACCTTGACAGTTTTGAGG + Intergenic
995894995 5:117002231-117002253 TGATGACAATGGCGGTTTTGTGG - Intergenic
995942141 5:117599444-117599466 TGATGACAATGGCGGTTTTGTGG - Intergenic
995994595 5:118283069-118283091 TGATGACGATGGCGGTTTTGTGG + Intergenic
996069754 5:119121748-119121770 GGATGACAATGGCGGTTTTGTGG - Intronic
996386198 5:122913180-122913202 TGATGACAATGGCGGTTTTGTGG - Intronic
996598225 5:125229744-125229766 TGATGACCTTGACAGTTTTGAGG + Intergenic
997321534 5:132982859-132982881 TGATGACAATGGCGGTTTTGTGG - Intergenic
997336065 5:133109302-133109324 GGATGACAATGGCGGCTTTGTGG + Intergenic
997565161 5:134881654-134881676 TGATGACAATGGCAGTTTTGTGG - Intronic
997656107 5:135555724-135555746 TGATGACTGTGACAGTTTTGAGG + Intergenic
997874636 5:137537461-137537483 TGATGACAAGGGTGGTTTTGTGG - Intronic
997892517 5:137687693-137687715 TGATGACAATGGCGGTTTTGTGG + Intronic
997930958 5:138070872-138070894 TGATGACAATGGCGGTTTTGTGG + Intergenic
998021638 5:138776511-138776533 TGATGACGATGGCGGTTTTGTGG - Intronic
998025156 5:138810756-138810778 TGATGACAATGGCGGTTTTGTGG - Intronic
998053802 5:139056845-139056867 TGATGACAATGGCGGTTTTGTGG + Intronic
998060163 5:139112826-139112848 TGATGACAATGGCAGTTTTGTGG + Intronic
998067659 5:139171228-139171250 GGATGACAATGGCGGTTTTGTGG + Intronic
998074517 5:139224817-139224839 TGATGACAATGGCGCTTTTGTGG + Intronic
998099699 5:139422147-139422169 TGCTGACGATGGCTGGTCTGGGG + Intronic
998239126 5:140426983-140427005 TGATGACAATGGCTGTTTTGTGG - Intronic
998431565 5:142075116-142075138 GGATGACAATGGCGGCTTTGTGG - Intergenic
999603801 5:153296041-153296063 TGATGACAATGGCGGATTTGTGG - Intergenic
999987130 5:157014611-157014633 TGATGACAATGGTGGTTTTGTGG + Intergenic
1000033126 5:157420158-157420180 TGATGACAATGGCGGTTTTGTGG + Intronic
1000159529 5:158583509-158583531 TGATGACAATGGCGGTTTTGTGG + Intergenic
1000425391 5:161084293-161084315 TGATGACCATGGCAGTTTTGAGG - Intergenic
1000644026 5:163739353-163739375 TGATGACTTTGAGGGTTTTGAGG + Intergenic
1000939403 5:167342254-167342276 TGACCACCATGGCAGTTTTGAGG + Intronic
1000985909 5:167860570-167860592 GGATGACAATGGCGGCTTTGTGG + Intronic
1001077697 5:168643121-168643143 GGATGACAATGGCGGCTTTGTGG - Intergenic
1001366676 5:171147917-171147939 TGATGACAATGGCGGTTTTGTGG + Intronic
1001393890 5:171403473-171403495 GGATGACGATGGCAGCTTTGTGG - Intronic
1002007926 5:176252048-176252070 TGATGACAATGGTGGTTTTGTGG - Intronic
1002014244 5:176306440-176306462 GGATGACAATGGCGGCTTTGTGG + Intronic
1002031702 5:176434343-176434365 TGATGACAATGGTAGTTTTGTGG + Intergenic
1002116284 5:176962675-176962697 GGATGACAATGGCGGCTTTGTGG + Intronic
1002205419 5:177559933-177559955 GGATGACAATGGCGGCTTTGTGG - Intergenic
1002338685 5:178499544-178499566 TGATGACCTTGACAGTTTTGAGG - Intronic
1002341292 5:178518363-178518385 GGATGACAATGGCTGCTTTGTGG - Intronic
1002501470 5:179650287-179650309 TGATGACGATGGCGGTTTTGTGG - Intergenic
1002529362 5:179834870-179834892 TGATGACAATGGCGGCTTTGTGG - Intronic
1002658235 5:180771142-180771164 TGATGACAATGGCGGTTTTGTGG - Intergenic
1003319217 6:5037476-5037498 TGATGACAATGGCGGTTTTGTGG - Intergenic
1003407221 6:5835349-5835371 TGATGACAATGGCGGTTTTGTGG - Intergenic
1003519363 6:6844611-6844633 TGATGACTTTGGCAGTTTTGAGG + Intergenic
1004388564 6:15190098-15190120 GGATGACAATGGCGGCTTTGTGG + Intergenic
1004414738 6:15415281-15415303 TGATGACAATGGCGGTTTTGTGG - Intronic
1004448632 6:15726024-15726046 GGATGACAATGGCGGCTTTGTGG - Intergenic
1004496723 6:16171219-16171241 TGATGACCTTGATGGTTTTGAGG - Intergenic
1004664038 6:17735136-17735158 TGATGACAATGGCGGTTTTGTGG - Intergenic
1004799325 6:19128884-19128906 TGATGACCTTGACAGTTTTGAGG - Intergenic
1004874828 6:19940679-19940701 TGATGACAGTGGCAGTTTTGTGG + Intergenic
1005063214 6:21796597-21796619 TGATGACAGTGGCAGTTTTGTGG - Intergenic
1005069461 6:21851197-21851219 TGATGACAATGGCGGTTTTGTGG - Intergenic
1005159103 6:22837407-22837429 TGATGACAATGGCAGTTTTGTGG + Intergenic
1005233386 6:23731794-23731816 TGATGACGAGGGCAGTTTTGAGG - Intergenic
1005606593 6:27484568-27484590 GGATGACAATGGCGGCTTTGTGG - Intergenic
1005644276 6:27826644-27826666 GGATGACAATGGCGGCTTTGTGG - Intergenic
1005837664 6:29719788-29719810 TGATGACAATGGCGGTTTTGTGG + Intergenic
1005865531 6:29933268-29933290 TGATGACAATGGCGGTTTAGTGG + Intergenic
1005901659 6:30221950-30221972 TGATGACAATGGCAGTTTTGTGG - Intergenic
1005929918 6:30475513-30475535 GGATGACAATCGCGGTTTTGTGG + Intergenic
1006004685 6:30993035-30993057 TGATGACGATGGCGGTTTTGTGG - Intergenic
1006040062 6:31244830-31244852 GGATGACAATGGCGGCTTTGTGG + Intergenic
1006064470 6:31454214-31454236 GGATGACAATGGCGGTTTTGTGG - Intergenic
1006128188 6:31853750-31853772 GGATGACAATGGCGGCTTTGTGG - Intergenic
1006141275 6:31931730-31931752 TGATGACAATGACGGTTTTGTGG - Intronic
1006148823 6:31975746-31975768 CGATGACAATGGTGGTTTTGTGG - Intronic
1006209635 6:32384652-32384674 TGATGACAATGGCGGTTTTGTGG - Intergenic
1006231801 6:32594649-32594671 GGATGACAGTGGCGGCTTTGTGG - Intergenic
1006346213 6:33485532-33485554 TGATGACAATGGCGGTTTTGTGG - Intergenic
1006351741 6:33525676-33525698 GGATGACAATGGCGACTTTGTGG + Intergenic
1006403706 6:33832407-33832429 TGATGACAATGGCGGTTTTGTGG - Intergenic
1006492745 6:34398654-34398676 GGATGACAATGGCGGCTTTGTGG + Intronic
1006546831 6:34787067-34787089 TGATGACAATGGCGGTTTTGTGG + Intergenic
1006617677 6:35340843-35340865 GGATGACAATGGCGACTTTGTGG + Intergenic
1006624109 6:35385163-35385185 GGATGACAATGGCGGCTTTGTGG + Intronic
1006721078 6:36151783-36151805 CGATGACCTTGGTGGTTTTGAGG + Intergenic
1007063342 6:38964163-38964185 GGATGACAATGGCGGCTTTGTGG - Intronic
1007403286 6:41616720-41616742 TGATGACAATGGCGGTTTTGTGG + Intergenic
1007523152 6:42466938-42466960 TGATGGCAATGGCGGTTTTGTGG + Intergenic
1007674026 6:43580376-43580398 TGATGACAATGGCGGCTTTGTGG - Intronic
1008111998 6:47505495-47505517 GGATGACAATGGCGGCTTTGTGG - Intronic
1008184255 6:48371131-48371153 TGATGACAGTGGCAGTTTTGTGG - Intergenic
1008480777 6:51982337-51982359 TGATGACAATGGCGGTTTTGTGG + Intronic
1008553475 6:52655447-52655469 TGATGACAATGGCGGTTTTGTGG - Intergenic
1008624533 6:53304892-53304914 TGATGACAATGGTGGTTTTGTGG - Intronic
1008841448 6:55909783-55909805 TGATGACAATGGCGGTTTTGTGG - Intergenic
1008919319 6:56825026-56825048 TGATGACAATGGCGGTTTTGTGG + Intronic
1008926137 6:56894065-56894087 TGATGACAATGGCGGTTTTGTGG - Intronic
1009049158 6:58258108-58258130 TGATGACGATGGTGGTTTTGTGG + Intergenic
1010030197 6:71265876-71265898 TGATGACAATGGCGGTTTTGTGG - Intergenic
1010200978 6:73281878-73281900 TGATGACCTTGACAGTTTTGAGG + Intronic
1010239510 6:73601966-73601988 GGATGACAATGGCGGTTTTGTGG + Intronic
1010245743 6:73660309-73660331 TGATGACAATGGCGGTTTTGTGG - Intergenic
1010264312 6:73850895-73850917 TGATGACAATGGCGGTTTTGTGG - Intergenic
1010270807 6:73914754-73914776 TGATGACAATGGCGGTTTTGTGG - Intergenic
1010300560 6:74254981-74255003 TGATGACGATGGCGGTTTTGTGG - Intergenic
1010319449 6:74489060-74489082 TGATGACAATGGTGGTTTTGTGG + Intergenic
1010400377 6:75441447-75441469 TGATGACAATGGCGGTTTTGTGG - Intronic
1010513377 6:76745025-76745047 GGATGACAATGGCGGCTTTGTGG + Intergenic
1011148395 6:84244227-84244249 TGATGACATTGGCGGTTTTGTGG - Intergenic
1011297432 6:85839211-85839233 TGATGACAATGGCGGTTTTGTGG + Intergenic
1011404950 6:87009528-87009550 GGATGACAATGGCGGCTTTGTGG - Intronic
1011425335 6:87222860-87222882 TGATGACCTTGACAGTTTTGAGG + Intronic
1011475933 6:87750838-87750860 TGATGACAATGGCGGTTTTGTGG - Intergenic
1011588530 6:88948639-88948661 GGATGACAATGGCGGCTTTGTGG + Intronic
1012428778 6:99142394-99142416 TGATGACAATGGCGGTTTTGTGG + Intergenic
1012479265 6:99649997-99650019 TGATGACAATGGCCGTTTAGTGG - Intergenic
1012494260 6:99816987-99817009 TGATGACCTTGACAGTTTTGAGG + Intergenic
1012983478 6:105853571-105853593 GGATGACAATGGCGGTTTTGTGG - Intergenic
1013185737 6:107756446-107756468 TGATGACTTTGGCAGTTTTGAGG - Intronic
1013190957 6:107803577-107803599 TGATGACAATGGCGGTTTTGTGG + Intronic
1013204890 6:107935318-107935340 GGATGACAATGGCGGTTTTGTGG + Intronic
1013206971 6:107953994-107954016 TGATGACAATGGCGGTTTTGTGG + Intronic
1013244092 6:108270462-108270484 TGATGACAATGGCGGTTTTGTGG + Intergenic
1013326292 6:109047622-109047644 GGATGACAATGGCGGCTTTGTGG + Intronic
1013402945 6:109816350-109816372 TGATGACGTTGATGGTTTGGAGG - Intronic
1013638112 6:112047883-112047905 TGATGACAATGGCGGTTTTGTGG + Intergenic
1013679513 6:112508802-112508824 GGATGACAATGGCGGCTTTGTGG - Intergenic
1013681200 6:112528128-112528150 TGATGACAATGGCGGTTTTGTGG - Intergenic
1014491772 6:122071350-122071372 TGATGACCTTGACAGTTTTGAGG + Intergenic
1014556610 6:122848253-122848275 GGATGACAATGGCGGCTTTGTGG - Intergenic
1014763752 6:125388154-125388176 TGATGACAATGGCGGTTTTGTGG - Intergenic
1014800429 6:125771174-125771196 TGATGACGATGGCGGTTTTGTGG + Intergenic
1015070524 6:129088360-129088382 TGATGATGATGGTGGTTTTGTGG - Intronic
1015221000 6:130802837-130802859 TGATGACAATGGCAGTTTTGTGG + Intergenic
1015252809 6:131144228-131144250 TGATGACAATGGCGGTTTTGTGG - Intronic
1015477039 6:133665711-133665733 GGATGACAATGGCGGCTTTGTGG + Intergenic
1015567869 6:134592177-134592199 TGATAACCTTGGCTGTTTTGAGG - Intergenic
1016476314 6:144433152-144433174 TGATGACAATGGCGGTTTTGTGG - Intronic
1016479828 6:144470167-144470189 TGATGACGATGGCAGTTTTGTGG - Intronic
1016765596 6:147789768-147789790 TGATGACTGTGACGGTTTTGAGG + Intergenic
1016802045 6:148178613-148178635 TGATGACAGTGGCAGTTTTGTGG - Intergenic
1016973343 6:149785874-149785896 GGATGACAATGGCGGCTTTGTGG - Intronic
1017203816 6:151783863-151783885 TGATGACCTTGACAGTTTTGAGG + Intronic
1017214876 6:151898866-151898888 TGATGACAATGGCAGTTTTGTGG - Intronic
1017420001 6:154263712-154263734 GGATGACAATGGCGGTTTTGTGG - Intronic
1017493670 6:154966066-154966088 TGATGACAATGGCGGTTTTGTGG - Intronic
1017504640 6:155056951-155056973 TGATGACTGTGACAGTTTTGAGG + Intronic
1017660801 6:156670693-156670715 TGATGACAATGGCGGTTTTGTGG + Intergenic
1017830903 6:158127524-158127546 GGATGACAATGGCGGCTTTGTGG + Intronic
1017843173 6:158238894-158238916 GGATGACAATGGCGGCTTTGTGG - Intronic
1017851272 6:158308468-158308490 TGATGACAATGGCGGTTTTGTGG - Intronic
1018009977 6:159660758-159660780 TGATGACAATGGCGGTTTTGTGG + Intergenic
1018295561 6:162339666-162339688 TGATGACAATGGTGGCTTTGTGG + Intronic
1019439796 7:1039700-1039722 GGATGACAATGGCGGCTTTGTGG + Intronic
1019458626 7:1145947-1145969 TGATGACAATGGCGGTTTTGTGG - Intergenic
1019669395 7:2269057-2269079 GGATGACAATGGCGGCTTTGTGG + Intronic
1019674658 7:2303482-2303504 GGATGACAATGGCGGTTTTGTGG + Intronic
1019714797 7:2533959-2533981 TGATGACAATGGCGGTTTTGTGG - Intergenic
1019953137 7:4390066-4390088 TGATGACAATGGCGGTTTTGTGG - Intergenic
1019981467 7:4624428-4624450 TGATGACAATGGCGGTTTTGTGG + Intergenic
1020284524 7:6670689-6670711 TGATGACAATGGCGGTTTTGTGG - Intergenic
1020325803 7:6974825-6974847 TGATGACAATGGCAGTTTTGTGG - Intergenic
1020410014 7:7881772-7881794 TGATGACCTTGACAGTTTTGAGG + Intronic
1020498924 7:8890813-8890835 GGATGACGATGGCGGTTTTGTGG + Intergenic
1020616186 7:10465190-10465212 GGATGACAATGGCGGCTTTGTGG - Intergenic
1020831887 7:13103199-13103221 TGATGACAATGGCAGTTTTGTGG + Intergenic
1021120113 7:16789519-16789541 TGATGACAATGGCGGTTTTGTGG - Intergenic
1021230686 7:18083397-18083419 TTATGACCATGACAGTTTTGAGG - Intergenic
1021440522 7:20669254-20669276 TGATGACAATGGCGGTTTTGTGG + Intronic
1021647528 7:22801375-22801397 TGATGACAATGGCGGTTTTGTGG + Intergenic
1021672144 7:23045761-23045783 TGATGACAATGGCGGTTTTGTGG - Intergenic
1021735980 7:23638243-23638265 TGATGACAATGGCGGTTTTGTGG + Intronic
1021872807 7:25019743-25019765 GGATGACAATGGCGGCTTTGCGG + Intergenic
1021992027 7:26148586-26148608 TGATGACAATGGCGGTTTTGCGG + Intergenic
1022005589 7:26262547-26262569 GGATGACAATGGCGGTTTTGTGG + Intergenic
1022083608 7:27045675-27045697 TGATGACAATGGCGGTTTTGTGG + Intergenic
1022274149 7:28839053-28839075 TGATGACAATGGCAGTTTTGTGG + Intergenic
1022318292 7:29264341-29264363 TGATGACAATGGCGGTTTTGTGG + Intronic
1022393190 7:29961536-29961558 GGATGACAATGGCGGCTTTGTGG - Intronic
1022663377 7:32387341-32387363 TGATGACAATGGCGGTTTTGTGG - Intergenic
1022997637 7:35774178-35774200 TGATGACCTTGACAGTTTTGAGG - Intergenic
1023044292 7:36197441-36197463 TGATGACGATAGCAGTTTTGTGG + Intronic
1023902775 7:44496572-44496594 TGATGACCTTGACAGTTTTGAGG - Intergenic
1024309962 7:47959897-47959919 TGATGACAATGGCGGTTTTGTGG + Intronic
1024539039 7:50460577-50460599 TGATGACAATGGCGGTTTTGTGG + Intronic
1024931085 7:54667480-54667502 TGATGACAATGGCGGTTTTGTGG - Intergenic
1024988855 7:55219543-55219565 GGATGACAATGGCGGCTTTGTGG - Intronic
1025011356 7:55402008-55402030 TGATGACAATGGCGGTTTTGTGG - Intronic
1025103503 7:56152057-56152079 TGATGACAATGGTGGTTTTGTGG + Intergenic
1025572894 7:62599571-62599593 TGATGACAATGGTGATTTTGTGG - Intergenic
1025707001 7:63874695-63874717 TGATGACGGTGGCGGTTTTGTGG + Intergenic
1025778346 7:64577647-64577669 TGATGACAATGGCGGTTTTGTGG + Intergenic
1025793792 7:64718398-64718420 TGATGACAATGGTGGTTTTGTGG + Intergenic
1025795767 7:64738255-64738277 GGATGACAATGGCGGTTTTGTGG - Intergenic
1025800957 7:64785232-64785254 TGATGACCGTGGCGGTTTTGTGG + Intergenic
1025803409 7:64809051-64809073 GGATGACAATGGCGGCTTTGTGG - Intronic
1025808609 7:64857176-64857198 TGATGACAATGGCGGTTTTGTGG + Intergenic
1025821270 7:64967396-64967418 TGATGACAATGGTGGTTTTGTGG - Intergenic
1025853519 7:65259767-65259789 TGATGACAATGGCGGTTTTGTGG + Intergenic
1025979073 7:66393199-66393221 TGATGACAATGGCGGTTTTGTGG - Intronic
1026008109 7:66615019-66615041 TGATGACGATGGCGGTTTTGCGG + Intergenic
1026042159 7:66877235-66877257 TGATGACAATGGCGGTTTTGTGG - Intergenic
1026783132 7:73283755-73283777 GGATGACAATGGAGGCTTTGTGG - Intergenic
1026868556 7:73836810-73836832 GGATGACAATGGCGGCTTTGTGG + Intronic
1027087580 7:75275256-75275278 GGATGACAATGGCGGCTTTGTGG + Intergenic
1027371445 7:77510106-77510128 GGATGACAATGGCGGCTTTGTGG + Intergenic
1027373677 7:77533367-77533389 GGATGACAATGGCGGCTTTGTGG - Intergenic
1028227175 7:88265947-88265969 TGATGACAATGGCGGTTTTGTGG - Intergenic
1028430691 7:90744477-90744499 TGATGACAATGGCGGTTTTGTGG - Intronic
1028685387 7:93585689-93585711 TGATGACAATGGCGGTTTTGTGG - Intergenic
1029279711 7:99427632-99427654 TGATGACAGTGGCGGTTTTGTGG + Intronic
1029334316 7:99887776-99887798 TGATGACAATGGTGGTTTTGTGG - Intronic
1029429652 7:100522664-100522686 TGATGACAATGGCGGTTTTGTGG - Intergenic
1029468415 7:100740767-100740789 GGATGACAATGGCGGCTTTGTGG - Intronic
1029525843 7:101092865-101092887 TGATGACGATGGCGGTTTTGTGG + Intergenic
1029568894 7:101358464-101358486 GGATGACAATGGCGGTTTTGTGG - Intergenic
1029699906 7:102239543-102239565 TGATGACGGTGCTGGTTTTCAGG - Exonic
1030036126 7:105410472-105410494 TGATGACAATGGCGGTTTTGTGG - Intergenic
1030339777 7:108363843-108363865 TGATGACCTTGACAGTTTTGAGG - Intronic
1030368466 7:108671917-108671939 CGATGACAATGGCGGCTTTGTGG + Intergenic
1030603010 7:111610682-111610704 GGATGACAATGGCGGCTTTGTGG + Intergenic
1030652271 7:112128445-112128467 GGATGACAATGGCGGCTTTGTGG + Intronic
1030692835 7:112552134-112552156 TGATGACAATGGCGGTTTTGTGG + Intergenic
1030725811 7:112923005-112923027 TGATGACAATAGCGGTTTTGTGG + Intronic
1030824494 7:114138768-114138790 TGATGACCTTGACAGTTTTGAGG - Intronic
1032042673 7:128576477-128576499 TGATGACAATGGCGGTTTTGTGG - Intergenic
1032056804 7:128689936-128689958 TGATGACGATGGCGGTTTTGTGG + Intergenic
1032172215 7:129594356-129594378 TGATGACCTTGACAGTTTTGAGG + Intergenic
1032291451 7:130591928-130591950 TGATGACAATGGCGGTTTTGTGG + Intronic
1032570009 7:132985931-132985953 TGATGACCATGGCGGTTTTGTGG + Intronic
1032589437 7:133177843-133177865 TGATGACAATGGCAGTTTTGTGG + Intergenic
1032956086 7:136973356-136973378 TGATGACGGTGACGGTGTTAGGG + Intronic
1032956093 7:136973390-136973412 TGATGACGGTGACGGTGTTAGGG + Intronic
1032956100 7:136973424-136973446 TGATGACGGTGACGGTGTTAGGG + Intronic
1032956107 7:136973458-136973480 TGATGACGGTGACGGTGTTAGGG + Intronic
1032956114 7:136973492-136973514 TGATGACGGTGACGGTGTTAGGG + Intronic
1032956121 7:136973526-136973548 TGATGACGGTGACGGTGTTAGGG + Intronic
1032956128 7:136973560-136973582 TGATGACGGTGACGGTGTTAGGG + Intronic
1032956142 7:136973628-136973650 TGATGACGGTGACGGTGTTAGGG + Intronic
1033114326 7:138611923-138611945 GGATGACAATGGCGGCTTTGTGG + Intronic
1033173168 7:139101540-139101562 TGATGACGATGGCGGTTTTGTGG + Intronic
1033206754 7:139429838-139429860 TGATGACAATGGCAGTTTTGTGG - Intergenic
1033219646 7:139519982-139520004 TGATGACAATGGCAGTTTTGTGG - Intergenic
1033324134 7:140363221-140363243 TGATGACAATGGCGGTTTTGTGG + Intronic
1033333176 7:140431917-140431939 TGATGACAATGGCGGTTTTGTGG + Intergenic
1033376031 7:140763074-140763096 TGATGACAATGGCGGTTTTGTGG - Intronic
1033413392 7:141140700-141140722 TGGTGACTTTGACGGTTTTGAGG + Intronic
1034034057 7:147801790-147801812 TGATGACAATGGCGGTTTTGTGG - Intronic
1034200286 7:149279935-149279957 GGATGACAATGGCGGTTTTGTGG - Intronic
1034234415 7:149555373-149555395 GGATGACAATGGCGGTTTTGTGG + Intergenic
1034322704 7:150199133-150199155 GGATGACAATGGCGGCTTTGTGG + Intergenic
1034361781 7:150506178-150506200 TGATAACAATGGCGGTTTTGTGG - Intergenic
1034510310 7:151528707-151528729 TGACGACCTTGGCAGTTTTGAGG + Intergenic
1034638291 7:152585118-152585140 TGATGACAATGGCGGTTTTGTGG - Intergenic
1034723201 7:153314510-153314532 AGATGACAATGGCGGTTTTGTGG - Intergenic
1034961313 7:155366548-155366570 TGATGACAATGGCGGCTTTGTGG - Intronic
1035412673 7:158657680-158657702 TGATGACAATGGCGGTTTTGTGG + Intronic
1035507653 8:149313-149335 GGATGACAATGGCGGCTTTGTGG - Intergenic
1035844989 8:2853293-2853315 TGATGACGTTAGCAGTGTTGAGG - Intergenic
1036096081 8:5725744-5725766 TGATGACAATGGCAGTTTTGTGG + Intergenic
1036482903 8:9153871-9153893 GGATGACAATGGCGGCTTTGTGG - Intronic
1036506868 8:9364841-9364863 GGATGACAATGGCGGTTTTGTGG - Intergenic
1036536450 8:9657087-9657109 GGATGACAATGGCGGCTTTGTGG - Intronic
1036737354 8:11330446-11330468 TGATGACGATGGCGGTTTTGTGG + Intergenic
1037743441 8:21625230-21625252 TGATGACCTTGACTGTTTTGAGG - Intergenic
1037756244 8:21712148-21712170 TGATGACAATGGCGGTTTTGTGG - Intronic
1038505744 8:28083390-28083412 TGATGAATATGGCAGTTTTGAGG - Intronic
1038595507 8:28881982-28882004 TGATGACAATGGCGGTTTTGTGG + Intronic
1038741004 8:30216784-30216806 TGATGACCTTGACAGTTTTGAGG - Intergenic
1038744594 8:30246392-30246414 TGATGACAATGGCGGTTTTGTGG - Intergenic
1039072093 8:33658002-33658024 TGATGACAATGGCGGTTTTGTGG - Intergenic
1039153033 8:34528455-34528477 GGATGACAATGGCGGTTTTGTGG - Intergenic
1039346933 8:36715247-36715269 TGATGACTTTGACTGTTTTGAGG + Intergenic
1039488325 8:37928226-37928248 TGATGACAATGGCGGTTTTGTGG + Intergenic
1039515961 8:38133851-38133873 TGATGACGATGGCGGTTTTGTGG + Intronic
1039881067 8:41626177-41626199 GGATGACAATGGCGGTTTTGTGG - Intergenic
1040043307 8:42939184-42939206 TGATGACAATGGCGGTTTTGTGG - Intronic
1040052730 8:43032857-43032879 TGATGACAATGGCGGTTTTGTGG - Intronic
1040069504 8:43179078-43179100 TGATGACAATGGCGGTTTTGTGG - Intronic
1040093118 8:43419089-43419111 TGATGACAATGGCGGTTTTGTGG - Intergenic
1040121132 8:43687340-43687362 AGATGACAATGGTGGCTTTGTGG - Intergenic
1040576927 8:48660643-48660665 AGATGACATTGGCAGTTTTGAGG + Intergenic
1040785686 8:51159711-51159733 TGATGACCATGGCGGTTTTGTGG + Intergenic
1040819052 8:51535245-51535267 TGATGACAATGGCGGTTTTGTGG + Intronic
1041071015 8:54125968-54125990 GGATGACAATGGCGGCTTTGTGG + Intergenic
1041088097 8:54275361-54275383 TGATGACCTTGACAGTTTTGAGG + Intergenic
1041270222 8:56104114-56104136 TGATGACAATGGTGGTTTTGTGG - Intergenic
1041286841 8:56271844-56271866 TGATGACAATGGCGGTTTTGTGG - Intergenic
1041358317 8:57022703-57022725 TGATGACAATGGCGGTTTTGTGG + Intergenic
1041362846 8:57071256-57071278 TGATGACAATGGCGTTTTTGTGG - Intergenic
1041513517 8:58676265-58676287 TGATGACAATGGCAGTTTTGTGG - Intergenic
1041644127 8:60234228-60234250 TGATGACCTTGACCGTTTTGAGG - Intronic
1041676702 8:60547363-60547385 TGATGACAATGGCGGTTTTGTGG - Intronic
1041796264 8:61752339-61752361 GGATGACAATGGCGGCTTTGTGG - Intergenic
1041822882 8:62059732-62059754 TGATGACACTGACAGTTTTGAGG - Intergenic
1041920662 8:63179685-63179707 TGATGGCGATGGCGGTTTTGTGG - Intronic
1042049352 8:64686656-64686678 GGATGACAATGGCGGCTTTGTGG + Intronic
1042139422 8:65663058-65663080 TGATGACAATGGCGGTTTTGTGG + Intronic
1042196277 8:66232965-66232987 TGATGACAATGGCAGTTTTGTGG + Intergenic
1042303897 8:67311765-67311787 GGATGACAATGGCGGCTTTGTGG + Intronic
1042307949 8:67350979-67351001 TGATGACAATGGCGGTTTTGTGG + Intergenic
1042319634 8:67461528-67461550 GGATGACAATGGCGGTTTTGTGG - Intronic
1042475912 8:69246388-69246410 GGATGACAATGGCGGCTTTGTGG + Intergenic
1043122133 8:76339514-76339536 TGATGACCTTGAGGGTTTTGGGG - Intergenic
1043284588 8:78513920-78513942 TGATGACCTTGACAGTTTTGAGG - Intergenic
1043697263 8:83236121-83236143 TGGTGATGATGAAGGTTTTGTGG + Intergenic
1043961474 8:86423689-86423711 TGATGATGATGGCGGTTTTGTGG - Intronic
1043985778 8:86693913-86693935 TGATGACAATGGCGGTTTTGTGG - Intronic
1044223981 8:89699657-89699679 TGATGACAATGGCGGTTTTGTGG + Intergenic
1044370762 8:91407881-91407903 TGATAACCTTGACGGTTTTGAGG - Intergenic
1044507765 8:93039738-93039760 TGATGACAGTGGCAGTTTTGTGG + Intergenic
1044568589 8:93692870-93692892 TGATGACCTTGACAGTTTTGAGG + Intergenic
1044661079 8:94591883-94591905 GGATGACAATGGCGGCTTTGCGG + Intergenic
1045024623 8:98074984-98075006 TGATGACTCTGACAGTTTTGAGG + Intronic
1045120114 8:99028179-99028201 TGATGACAATGGCGGTTTTGTGG - Intronic
1045298384 8:100891938-100891960 TGATGACAATGGCGGTTTTGTGG - Intergenic
1045524307 8:102928860-102928882 TGATGACAATGGCGGTTTTGTGG + Intronic
1045659268 8:104419726-104419748 TGATGACCATGACAGTTTTGAGG - Intronic
1046636946 8:116680354-116680376 TGATGACAATGGCGGTTTTGTGG + Intronic
1046716019 8:117568334-117568356 TGATGACCTTGACAGTTTTGAGG - Intergenic
1047088078 8:121541886-121541908 TGATGACCTTGACAGTTTTGAGG + Intergenic
1047099052 8:121656970-121656992 TGATGACAATGGCGGTTTTGTGG - Intergenic
1047267133 8:123316111-123316133 GGATGACAATGGCGGCTTTGTGG + Intergenic
1047388498 8:124431779-124431801 TGATGACAATGGCGGTTTTGTGG - Intergenic
1047687680 8:127317408-127317430 GGATGACAATGGCGGCTTTGTGG + Intergenic
1047719998 8:127630364-127630386 TGATGACAATGGCGGTTTTGTGG + Intergenic
1047781872 8:128118282-128118304 TGATGACAATGGCGGTTTTGTGG - Intergenic
1047847630 8:128825448-128825470 GGATGACAATGGCGGCTTTGTGG - Intergenic
1048061408 8:130922675-130922697 TGATGACAATGGCGGTTTTGTGG - Intronic
1048124395 8:131616851-131616873 TGATGACCATGACAGTATTGAGG + Intergenic
1048368750 8:133758593-133758615 TGATGACAATGGCGGTTTTGTGG + Intergenic
1048453671 8:134557285-134557307 TGATGACCTTGGAAGTTTTGAGG - Intronic
1049177258 8:141202016-141202038 TGATGACAATGGCGGTTTTGTGG - Intergenic
1049286693 8:141779672-141779694 TGATGATGGTGGTGGTATTGTGG + Intergenic
1049417496 8:142501921-142501943 TGATGGCGATGGCGGGGTGGTGG + Intronic
1049704976 8:144037345-144037367 TGATGACAATGGCGGTTTTGAGG + Intronic
1049739567 8:144231275-144231297 TGATGACAATGGCGGCTTTGTGG - Intronic
1049892450 9:83365-83387 TGATGACAATGGCGGTTTTGTGG - Intergenic
1050534978 9:6623143-6623165 TGATGACAATGGCGGTTTTGTGG + Intronic
1050557036 9:6798706-6798728 TGATGACAATGGCGGTTTTGTGG - Intronic
1050558386 9:6808221-6808243 GGATGACAATGGCGGCTTTGTGG + Intronic
1051258217 9:15234557-15234579 TGATGACAATGGCGGTTTTGCGG + Intronic
1051277114 9:15407256-15407278 GGATGACAATGGCGGCTTTGTGG + Intergenic
1051430511 9:16977209-16977231 TGATGACAGTGGCGGTTTTGTGG - Intergenic
1051661745 9:19433621-19433643 GGATGACAATGGTGGCTTTGTGG - Intronic
1051814128 9:21085196-21085218 TGATGACCTTGACAGTTTTGAGG - Intergenic
1052492550 9:29188540-29188562 TGATGACAATGGCGGTTTTGTGG - Intergenic
1052858843 9:33423939-33423961 TGATGACAATGGCGGTTTTGTGG + Intergenic
1052881151 9:33601352-33601374 TGATGACAATGGCGGTTTTGTGG + Intergenic
1052942180 9:34138267-34138289 TGATGACAATGGCGGTTTTGTGG + Intergenic
1053048238 9:34937177-34937199 TGATGATAATGGCGGTTTTGTGG + Intergenic
1053218684 9:36293668-36293690 TGATGAGGGTGGCTGTTTTAGGG - Intronic
1053255648 9:36614904-36614926 GGATGACAATGGGGGCTTTGTGG - Intronic
1053326052 9:37152554-37152576 TGATGACCATGTCAGTTTTGAGG + Intronic
1053457653 9:38243117-38243139 GGATGACAATGGCGGCTTTGTGG + Intergenic
1053468292 9:38325494-38325516 GGATGACAATGGCGGCTTTGTGG + Intergenic
1053634548 9:39983396-39983418 GGATGACAATGGCGGCTTTGTGG + Intergenic
1054209339 9:62267301-62267323 GGATGACAATGGCGGCTTTGTGG - Intergenic
1054359835 9:64101449-64101471 TGATGACCATGGCGGTTTTGCGG + Intergenic
1055133755 9:72806011-72806033 GGATGACAATGGCGGCTTTGTGG - Intronic
1055136901 9:72840058-72840080 GGATGACAATGGCAGCTTTGTGG - Intergenic
1055242298 9:74198168-74198190 TGATGACAATGGCGGTTTTGTGG + Intergenic
1055414025 9:76063796-76063818 GGATGACAATGGCGGCTTTGTGG - Intronic
1055506731 9:76955797-76955819 TGATGACAATGGCGGTTTTGTGG + Intergenic
1055518809 9:77060620-77060642 TGATGACAATGGCGGTTTTGTGG - Intergenic
1055586731 9:77762625-77762647 TGATGACAATGGTGGTTTTGTGG + Intronic
1055948752 9:81711437-81711459 GGATGACAATGGCGGCCTTGTGG + Intergenic
1056145910 9:83728907-83728929 TGATGACAATGGCGGTTTTGTGG + Intergenic
1056152902 9:83804996-83805018 GGATGACAATGGCAGTTTTGTGG + Intronic
1056336474 9:85573998-85574020 TGATGACAATGGCGGTTTTGTGG + Intronic
1056409673 9:86312640-86312662 TGATGACAATGGCGGTTTTGTGG + Intronic
1056563968 9:87758022-87758044 TGATGACAATGGCGGTTTTGTGG - Intergenic
1056624629 9:88244559-88244581 TGATGACAATGGCGGTTTTGTGG - Intergenic
1056670977 9:88626554-88626576 GGATGACAATGGCGGCTTTGTGG + Intergenic
1056706809 9:88959168-88959190 TGATGACAATGGCGGTTTTGTGG - Intergenic
1057087744 9:92227272-92227294 TGATGACAATGGCGGTTTTGTGG - Intronic
1057154633 9:92830531-92830553 TGATGACAATGGCGGTTTTGTGG - Intergenic
1057474482 9:95387033-95387055 TGATGACCTTGACAGTTTTGAGG + Intergenic
1057629294 9:96707304-96707326 GGATGACAATGGCGGCTTTGTGG - Intergenic
1057690108 9:97276406-97276428 TTCTGACGATGGGGGTTTGGGGG + Intergenic
1057751720 9:97797171-97797193 TGATGACAATGGCGGTTTTGTGG + Intergenic
1057894531 9:98897480-98897502 TGATGACCTTAACGGTTTTGAGG - Intergenic
1058019206 9:100068818-100068840 TGATGACAATGGCGTTTTTGTGG + Intronic
1058114155 9:101066126-101066148 TGATGACCTTGACGGTTTTGAGG + Intronic
1058534007 9:105936169-105936191 TGATGACTTTGACAGTTTTGAGG - Intergenic
1058659443 9:107256521-107256543 GGATGACAATGGCGGCCTTGTGG - Intergenic
1058661713 9:107272616-107272638 TGATGACAATGGCGGTTTTGTGG + Intergenic
1058723224 9:107777806-107777828 GGATGACAATGGCGGCTTTGTGG + Intergenic
1058972639 9:110097419-110097441 TGATGACAATGGCAGTTTTGTGG - Intronic
1059118051 9:111617313-111617335 TGATGACGATGGCGGTTTTGCGG - Intergenic
1059121388 9:111642137-111642159 GGATGACAATGGCGGCTTTGTGG + Intronic
1059211506 9:112515412-112515434 GGATGACAATGGCGGCTTTGCGG + Intronic
1059242557 9:112819680-112819702 GGATGACCATGACTGTTTTGAGG + Intronic
1059707698 9:116840343-116840365 GGATGACAATCGCGGCTTTGTGG - Intronic
1059742026 9:117161171-117161193 TGATGATGATGGTGGTGGTGGGG + Intronic
1060041605 9:120305316-120305338 TGATGACAATGGCGGTTTTGTGG + Intergenic
1060065496 9:120496938-120496960 GGATGACAATGGCGGCTTTGTGG + Intronic
1060249251 9:121971597-121971619 GGATGACAATGGCGGCTTTGTGG + Intronic
1060334817 9:122711467-122711489 TGATGACAATGGCGGTTTTGTGG + Intergenic
1060350332 9:122852909-122852931 TGATGACAATGGCGGTTTTGTGG + Intronic
1060352168 9:122868269-122868291 TGATGACAATTGCGGTTTTGTGG + Intronic
1060369540 9:123056942-123056964 TGATGACAATGGCGGTTTTGTGG - Intronic
1060651169 9:125328667-125328689 GGATGACAATGGCGGCTTTGTGG - Intronic
1060669661 9:125458683-125458705 GGATGACGATGGCGGTTTTGTGG - Intronic
1060682603 9:125577959-125577981 TGATGACAATGGCGGTTTTGTGG + Intronic
1060687546 9:125624767-125624789 GGATGACAATGGCGGCTTTGTGG + Intronic
1060703448 9:125779726-125779748 GGATGACAATGGCGGTTTTGTGG - Intronic
1061143235 9:128780677-128780699 TGATGACGATGGCGGTTTTGTGG + Intergenic
1061427053 9:130506359-130506381 TGATGACAATGGCAATTTTGTGG - Intergenic
1061562726 9:131416703-131416725 TGATGACCATGACAGTTTTGAGG + Intronic
1061635969 9:131908404-131908426 GCATGACAATGGCGGTTTTGTGG + Intronic
1061846550 9:133391392-133391414 TGATGGCAATGGCGGTTTTGTGG + Intronic
1061914950 9:133745039-133745061 TGATGACAATGGCGGTTTTGTGG + Intergenic
1061982563 9:134115249-134115271 GGATGACAATGGCGGCTTTGTGG - Intergenic
1062149911 9:135012693-135012715 TGATGACCTTGACAGTTTTGAGG + Intergenic
1062593908 9:137288675-137288697 GGATGACAATGGCGGCTTTGTGG + Intergenic
1062609525 9:137367766-137367788 TGAGGAGGATGGTGGTTTAGGGG + Intronic
1203463730 Un_GL000220v1:67821-67843 TGATGACAATGGCGGTTTTGTGG - Intergenic
1203562753 Un_KI270744v1:71921-71943 TGATGACAACAGCGGTTTTGTGG + Intergenic
1203634335 Un_KI270750v1:97061-97083 TGATGACAATCGCGGTTTTGTGG - Intergenic
1185585058 X:1236553-1236575 TGATGACGATGGCGGTTTTGTGG + Intergenic
1186244737 X:7608468-7608490 TGATGACAATGGCGGTTTTGTGG - Intergenic
1186398629 X:9235908-9235930 TGATGACCTTGACAGTTTTGAGG - Intergenic
1186787118 X:12963947-12963969 GGATGACAATGGCGGTTTTGTGG + Intergenic
1187184071 X:16968308-16968330 TGATGACAATGGCGGTTTTGTGG - Intronic
1187976274 X:24708852-24708874 GGATGACAATGGCAGCTTTGTGG - Intronic
1188179700 X:27039524-27039546 TGATGACCTTGACAGTTTTGAGG + Intergenic
1188367399 X:29333115-29333137 TGATGACAATGGCGGTTTTGTGG - Intronic
1188477557 X:30603408-30603430 GGATGACAATGGCGGCTTTGTGG + Intergenic
1188492639 X:30753823-30753845 TGATGACAATGGCAGTTTTGTGG - Intergenic
1188942805 X:36261791-36261813 TGATGACGATGGCGGTTTTGCGG - Intronic
1189056743 X:37707098-37707120 TGATGACAATGGCGGTTTTGTGG - Intronic
1189210556 X:39278538-39278560 TGATGACAGTGGCGGTTTTGTGG + Intergenic
1189458111 X:41211989-41212011 TGATGACAATGGCGGTTTTGTGG + Intronic
1189506141 X:41613159-41613181 TGATGACAATGGCGGTTTTGTGG + Intronic
1189569908 X:42285500-42285522 TGATGACAATGGCGGTTTTGTGG - Intergenic
1189587154 X:42473877-42473899 GGATGACTATGGCGGCTTTGTGG - Intergenic
1189626483 X:42902680-42902702 TGATGACCTTGACAGTTTTGAGG - Intergenic
1189837432 X:45039977-45039999 TGATGACAATGGCGGTTTTGTGG - Intronic
1189956069 X:46276170-46276192 GGATGACAATGGCGGCTTTGTGG + Intergenic
1189968152 X:46395124-46395146 TGATGACAATGGCGGTTTTGTGG - Intergenic
1190171686 X:48115876-48115898 TGATGACAATGGCAGTTTTGTGG + Intergenic
1190184609 X:48222732-48222754 TGATGACAATGGCGGTTTTGTGG + Intronic
1190241135 X:48659167-48659189 TGATGACAATGGCGGTTTTGTGG - Intergenic
1190521266 X:51280497-51280519 GGATGACAATCGCGGCTTTGTGG + Intergenic
1190680781 X:52826653-52826675 TGATGACAATGGTGGTTTTGTGG - Intergenic
1190779472 X:53579475-53579497 TGATGACAATGGCGGTTTTGTGG + Intronic
1190799150 X:53772439-53772461 TGATGACAATGGCGGTTTTGTGG - Intergenic
1190820549 X:53967642-53967664 TGATGACAATGGTGGTTTTGTGG + Intronic
1190839050 X:54128938-54128960 TGATGACAATGGCGGTTTTGTGG - Intronic
1190891410 X:54572472-54572494 GGATGACAATGGCGGCTTTGTGG - Intergenic
1191010253 X:55749562-55749584 TGATGACAATGGCGGTTTTGTGG + Intronic
1191068842 X:56379940-56379962 TGATGATGACGGCAGTTTTGTGG - Intergenic
1191617864 X:63189078-63189100 GGATGACAATGGCGGCTTTGTGG - Intergenic
1191637539 X:63393680-63393702 TGATGACAATGGCGGTTTTGTGG + Intergenic
1191835499 X:65457593-65457615 TGATGACAATGGCGGTTTTGTGG + Intronic
1192030254 X:67503636-67503658 TGATGACCTTGACAGTTTTGAGG - Intergenic
1192107242 X:68327306-68327328 TGATGACAATGGCGGTTTTGTGG + Intronic
1192352745 X:70371442-70371464 TGATGACAATGGCGGTTTTGTGG - Intronic
1192379594 X:70602003-70602025 TGATGACAATGGCGGTTTTGTGG - Intronic
1192386964 X:70680109-70680131 TGATGACAGTGGCGGTTTTGTGG + Intronic
1192463839 X:71341144-71341166 TGATGACAGTGGCAGTTTTGTGG - Intergenic
1192476886 X:71451943-71451965 TGATGACAATGGCAGTTTTGTGG - Intronic
1192568025 X:72179503-72179525 TGATGACAATGGCGGTTTTGTGG + Intergenic
1192621688 X:72682452-72682474 GGATGACAATGGCGGCTTTGTGG + Intronic
1192769003 X:74167657-74167679 GGATGACAATGGCGGTTTTGTGG + Intergenic
1192794068 X:74412429-74412451 TGATGACGATGGCGGTTTTGTGG - Intergenic
1192813296 X:74568374-74568396 TGATGACAGTGGCAGTTTTGTGG - Intergenic
1192969569 X:76217620-76217642 GGATGACAATGGCGGCTTTGTGG - Intergenic
1193068207 X:77279830-77279852 TGACGACAATGGCGGTTTTGTGG + Intergenic
1193114763 X:77766156-77766178 TGATGACAGTGGCGGTTTTGTGG - Intronic
1193132156 X:77931480-77931502 GGATGACAATGGCGGTTTTGTGG - Intronic
1193164490 X:78265311-78265333 TGATGACGGTGGTGGTTTTGTGG - Intergenic
1193207455 X:78765463-78765485 TGATGACAATGGCGGTTTTGTGG + Intergenic
1193345115 X:80396740-80396762 TGATGACAATGGTGGTTTTGTGG - Intronic
1193362433 X:80591773-80591795 TGATGACAATGGTGGTTTTGTGG + Intergenic
1193372458 X:80713218-80713240 TGATGACAATGGCGGTTTTGTGG + Intronic
1193782749 X:85723704-85723726 TGATGACAATGGCGGTTTTGTGG - Intergenic
1194611419 X:96050754-96050776 TGATGACAATGGCGGTTTTGTGG - Intergenic
1194992142 X:100556188-100556210 TGATGACAATGGCGGTTTTGTGG + Intergenic
1195010031 X:100724398-100724420 TGATGACAATGGCGGTTTTGTGG + Intronic
1195035922 X:100972196-100972218 GGATGACAATGGCGGCTTTGTGG - Intronic
1195257449 X:103104316-103104338 TGACGACAATGGCGGTTTTGTGG - Intergenic
1195896134 X:109747860-109747882 TGATGACCTTGACAGTTTTGAGG - Intergenic
1196404156 X:115346965-115346987 GGATGACAATGGCGGCTTTGTGG - Intergenic
1196778679 X:119362549-119362571 TGATGACAATGGCGGTTTTGTGG + Intergenic
1197199381 X:123734510-123734532 TGATGACAATGGCGGTTTTGTGG + Intergenic
1197241652 X:124128412-124128434 TGATGACAATGGCGGTTTTGTGG - Intronic
1197453070 X:126641862-126641884 TGATGACAATGGCGGTTTTGTGG + Intergenic
1197592397 X:128424414-128424436 TGATGATGCTGACAGTTTTGAGG + Intergenic
1197736317 X:129851498-129851520 TGATGACAGTGGCGGTTTTGTGG + Intergenic
1197897194 X:131327753-131327775 TGATGACAATGGCGGTTTTGTGG + Intronic
1198247016 X:134839889-134839911 TGATGACAATGGCGGTTTTGTGG + Intronic
1198260504 X:134960680-134960702 TGATGACAATGGCGGTTTTGTGG + Intergenic
1198476115 X:136999818-136999840 TGATGACAATGGCGGTTTTGTGG - Intergenic
1198778206 X:140204450-140204472 TGATAACTTTGGCAGTTTTGAGG + Intergenic
1198806056 X:140495929-140495951 TGATGACCTTGACAGTTTTGAGG + Intergenic
1199231064 X:145436654-145436676 TGATGACAATGGCGGTTTTGTGG + Intergenic
1199452521 X:147992125-147992147 GGATGACAATGGCAGCTTTGTGG - Intronic
1199586588 X:149421297-149421319 GGATGACAATGGCGGCTTTGTGG + Intergenic
1199859222 X:151784954-151784976 TGATGACTTTGACAGTTTTGAGG + Intergenic
1200280522 X:154773768-154773790 GGATGGCAATGGCGGTTTTGTGG - Intronic
1200387404 X:155907740-155907762 TGATGACAATGGCGGTTTTGTGG - Intronic
1200723491 Y:6634949-6634971 TGATGACTTTGACAGTTTTGAGG - Intergenic
1200952832 Y:8917951-8917973 TGATGACGATGGCGGTTTTGTGG - Intergenic
1201335871 Y:12879080-12879102 TGATGACAATGGCGGTTTTGTGG + Intergenic