ID: 1185587174

View in Genome Browser
Species Human (GRCh38)
Location X:1248735-1248757
Sequence CGCGGGCGGTACTGAATTAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185587157_1185587174 26 Left 1185587157 X:1248686-1248708 CCTCCCCCACCCCTGGAATTCCA No data
Right 1185587174 X:1248735-1248757 CGCGGGCGGTACTGAATTAACGG No data
1185587159_1185587174 22 Left 1185587159 X:1248690-1248712 CCCCACCCCTGGAATTCCAAAGG No data
Right 1185587174 X:1248735-1248757 CGCGGGCGGTACTGAATTAACGG No data
1185587168_1185587174 6 Left 1185587168 X:1248706-1248728 CCAAAGGCGCAGCCAGGCTCGGA No data
Right 1185587174 X:1248735-1248757 CGCGGGCGGTACTGAATTAACGG No data
1185587163_1185587174 17 Left 1185587163 X:1248695-1248717 CCCCTGGAATTCCAAAGGCGCAG No data
Right 1185587174 X:1248735-1248757 CGCGGGCGGTACTGAATTAACGG No data
1185587158_1185587174 23 Left 1185587158 X:1248689-1248711 CCCCCACCCCTGGAATTCCAAAG No data
Right 1185587174 X:1248735-1248757 CGCGGGCGGTACTGAATTAACGG No data
1185587156_1185587174 27 Left 1185587156 X:1248685-1248707 CCCTCCCCCACCCCTGGAATTCC No data
Right 1185587174 X:1248735-1248757 CGCGGGCGGTACTGAATTAACGG No data
1185587170_1185587174 -6 Left 1185587170 X:1248718-1248740 CCAGGCTCGGATTTCCACGCGGG No data
Right 1185587174 X:1248735-1248757 CGCGGGCGGTACTGAATTAACGG No data
1185587161_1185587174 21 Left 1185587161 X:1248691-1248713 CCCACCCCTGGAATTCCAAAGGC No data
Right 1185587174 X:1248735-1248757 CGCGGGCGGTACTGAATTAACGG No data
1185587165_1185587174 15 Left 1185587165 X:1248697-1248719 CCTGGAATTCCAAAGGCGCAGCC No data
Right 1185587174 X:1248735-1248757 CGCGGGCGGTACTGAATTAACGG No data
1185587164_1185587174 16 Left 1185587164 X:1248696-1248718 CCCTGGAATTCCAAAGGCGCAGC No data
Right 1185587174 X:1248735-1248757 CGCGGGCGGTACTGAATTAACGG No data
1185587162_1185587174 20 Left 1185587162 X:1248692-1248714 CCACCCCTGGAATTCCAAAGGCG No data
Right 1185587174 X:1248735-1248757 CGCGGGCGGTACTGAATTAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185587174 Original CRISPR CGCGGGCGGTACTGAATTAA CGG Intergenic
No off target data available for this crispr