ID: 1185593187

View in Genome Browser
Species Human (GRCh38)
Location X:1291963-1291985
Sequence GGTCCAGGTGGAGGTGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1448
Summary {0: 2, 1: 5, 2: 14, 3: 137, 4: 1290}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185593187_1185593195 18 Left 1185593187 X:1291963-1291985 CCTGCACCACCTCCACCTGGACC 0: 2
1: 5
2: 14
3: 137
4: 1290
Right 1185593195 X:1292004-1292026 GTCCCTACTCCACATTTACCTGG 0: 2
1: 1
2: 1
3: 13
4: 84
1185593187_1185593192 -6 Left 1185593187 X:1291963-1291985 CCTGCACCACCTCCACCTGGACC 0: 2
1: 5
2: 14
3: 137
4: 1290
Right 1185593192 X:1291980-1292002 TGGACCCAGTGTAGACAAAGAGG 0: 5
1: 4
2: 2
3: 24
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185593187 Original CRISPR GGTCCAGGTGGAGGTGGTGC AGG (reversed) Intronic
900095618 1:938959-938981 GGTCCAGGCTGAGCTGGAGCAGG + Intronic
900182748 1:1319508-1319530 GGTCCAGGTGGAAGTGGCTAGGG + Exonic
900199697 1:1398921-1398943 GGTCTAGGCGGGGGCGGTGCGGG + Intronic
900431250 1:2604176-2604198 GGTGCAGGAGGACATGGTGCAGG - Exonic
900475350 1:2873851-2873873 AGTCTAGCTGGAGGCGGTGCCGG + Intergenic
900627862 1:3617598-3617620 GGTCCATGTGCAGGATGTGCAGG - Intergenic
900686840 1:3954183-3954205 GGTCCATGTGCAGGATGTGCAGG + Intergenic
900975125 1:6011963-6011985 GGTGGAGGTGGAGGTGATGAAGG + Intronic
900975139 1:6012011-6012033 GGTAGAGGTGGAGGTGATGGAGG + Intronic
900975188 1:6012223-6012245 GGTGGAGGTGGAGGTGATGAAGG + Intronic
900975318 1:6012719-6012741 GGTCATGGTGGAGGTGATGGGGG + Intronic
900982727 1:6055705-6055727 GGTCAGGGTGAAGGTGGGGCGGG + Intronic
901109939 1:6785887-6785909 GGTCCGGGTGGGGGAGGCGCCGG - Intronic
901187368 1:7383715-7383737 GGTGATGGTGGTGGTGGTGCTGG + Intronic
901502035 1:9658412-9658434 TGTCCAGGTGAGGGTGGGGCTGG + Intronic
901511728 1:9721068-9721090 GGTCAGGGTGGAGGTGGTCAGGG - Intronic
901526334 1:9825118-9825140 GCTCCAGGTGGGGGTGGAGGAGG + Intergenic
901567541 1:10131053-10131075 GGGCCAGCTGGAGGAGGAGCCGG - Intronic
901893306 1:12286757-12286779 GGTTCAAGTGGTGGTGGTGGTGG + Intronic
902366672 1:15979736-15979758 GGTACATGTGCAGGAGGTGCAGG + Intergenic
902618112 1:17634904-17634926 GCCCCAGGTGCAGGTGGTGGAGG + Exonic
903007760 1:20309791-20309813 AGTCCAGGCAGAGGTGGTGGTGG + Intronic
903558742 1:24212162-24212184 GGTGGTGGTGGAGGTGGTGAGGG + Intergenic
903560032 1:24220277-24220299 GGCCCCTGAGGAGGTGGTGCGGG - Intergenic
903575090 1:24334739-24334761 GCTCCAGGTGGAGGTGGGGAAGG - Intronic
904029876 1:27527521-27527543 GGACTAGGTGGAGGGGGTGGTGG - Intergenic
904325131 1:29723369-29723391 GGTCATGGTGGTGGTGGTGATGG - Intergenic
904627336 1:31814504-31814526 GAGCCAGGTGGAAGTGGGGCAGG - Exonic
904954989 1:34275635-34275657 GGTTCATGAGGAAGTGGTGCTGG + Intergenic
905106307 1:35565540-35565562 TGTCCTGGTGGAGCTGGCGCGGG + Exonic
905494921 1:38377436-38377458 GATGGAGGTGGAGGTGGGGCTGG + Intergenic
905511221 1:38522034-38522056 GGGCAAGGTGGCTGTGGTGCCGG - Intergenic
905630391 1:39515087-39515109 GGACCCGGTGGAGATGGTGAAGG + Intronic
905632334 1:39525561-39525583 GGAGCAGGTGGAGCTGGGGCGGG + Intronic
905667370 1:39771102-39771124 GGACCCGGTGGAGATGGTGAAGG - Exonic
905895701 1:41544702-41544724 GGTACAGGTGGTAGTGGTGGTGG - Intronic
906140410 1:43530998-43531020 GGACCAGGTGGAGGCGGCGGCGG + Exonic
906564005 1:46783675-46783697 TGTTCTGGTGGAGGTGGTGGAGG + Intronic
906597941 1:47096517-47096539 GGTACATGTGGAGGATGTGCAGG + Intronic
906867194 1:49434689-49434711 GGTGGTGGTGGTGGTGGTGCTGG + Intronic
906867199 1:49434704-49434726 GGTGCTGGTGGTGGTGGTGGTGG + Intronic
907807676 1:57837784-57837806 GGTGGAGGTGGGGGTGGTGAAGG - Intronic
911055185 1:93702541-93702563 GGCCCAGGTGGGGGTGGGGATGG + Intronic
911383448 1:97144994-97145016 GGTGATGGTGGTGGTGGTGCTGG + Intronic
911945878 1:104108270-104108292 GGACCAGGTGGAGGTCATGGGGG + Intergenic
912153898 1:106892192-106892214 GGTACAGGTGCAGGATGTGCAGG - Intergenic
912271950 1:108220338-108220360 GGTACATGTGGAGGATGTGCAGG - Intergenic
912470681 1:109904836-109904858 GGGCCAGGAGGATGTGGGGCAGG - Intergenic
912525694 1:110281061-110281083 GGTGGTGGTGGTGGTGGTGCGGG + Intronic
912680214 1:111724612-111724634 GGTGGAGGTGGTGGTGGTGGTGG - Exonic
912708692 1:111934053-111934075 GGCCCTGGGGAAGGTGGTGCGGG + Intronic
912725732 1:112057485-112057507 GCTCCTGGTGGAGGTGGTGAGGG - Intergenic
913522412 1:119657522-119657544 GGTCCAGGATGAGGGGGTGAGGG + Intergenic
914196063 1:145448700-145448722 GATCCAGGTGGGAGTGGTGAGGG - Intergenic
914719321 1:150276416-150276438 GGGCTGGGTGGAGGTGGTGAAGG + Intronic
914901818 1:151715179-151715201 GTGCCAGGTGGAGGGGGAGCTGG + Intronic
914912944 1:151801573-151801595 AGTCCAGGTGGCGGCGGAGCCGG + Exonic
914947146 1:152077975-152077997 GGTTCTGGTGGAGATGGTACAGG + Intergenic
915065169 1:153218912-153218934 GGTGGTGGTGGAGGTGGTGGTGG - Exonic
915068045 1:153243313-153243335 GGTGGAGGTGGTGGTGGTGGTGG + Intergenic
915068065 1:153243407-153243429 GGTACAGGTGTTGGTGGTGGTGG + Intergenic
915068339 1:153244635-153244657 GGTGCAGGTGGTGGAGGTGGTGG + Intergenic
915068398 1:153245073-153245095 GGTGGAGGTGGTGGTGGTGATGG + Intergenic
915288751 1:154869206-154869228 GGTGCTGCTGGCGGTGGTGCCGG + Exonic
915368130 1:155326719-155326741 GGCCCAGGGGCAGGTGGTGGTGG - Exonic
915601275 1:156924494-156924516 CATCCAGGTGGAGCTGGAGCAGG + Exonic
915609281 1:156978241-156978263 GGTAGAGGTGGAGGAGGTGGTGG + Exonic
916564390 1:165960692-165960714 GGTGGAGGTGGTGGTGGTGATGG + Intergenic
916952370 1:169794140-169794162 TGTCCAGGTGGTAGTGGTGGTGG - Intronic
917123534 1:171665386-171665408 GGTGGGGGTGGAGGTGGTGATGG - Intergenic
919059164 1:192608821-192608843 GGTGGAGGCGGAGGTGGTGGTGG - Intergenic
919115475 1:193275865-193275887 TGTTCTGGTGGAGGTGGTGGGGG + Intergenic
919141750 1:193581476-193581498 GGCACAGGTGGTGGTGGTGTTGG - Intergenic
919297228 1:195718396-195718418 GGTAAAGGTGGAGTTGGTGCTGG + Intergenic
920098182 1:203500051-203500073 GGTGGAGGTGGTGGTGGTGGAGG - Intronic
920245614 1:204585443-204585465 GGTGCAGATGGAGGGGATGCGGG - Intergenic
920796241 1:209140022-209140044 GGTGTTGGTGGATGTGGTGCAGG + Intergenic
921017706 1:211207513-211207535 GTTCCAGGTGAAGGTGGTCATGG - Intergenic
921129631 1:212208632-212208654 GGGCCTGGTGGTGGTGGTGGTGG + Intergenic
921890090 1:220344902-220344924 GGCCCACGTGGATGTGGTGTAGG + Intergenic
922077759 1:222264728-222264750 TGTACAGGAGGAGGTGGTCCAGG - Intergenic
922804169 1:228377178-228377200 GGGCCAGGTGCGGGTGGCGCAGG - Exonic
922804274 1:228377561-228377583 GGTCCAGGTGCAGGATGTGCTGG - Exonic
923032639 1:230262395-230262417 GGTCCAGCTCGAGGTGCTGGTGG + Intronic
923194938 1:231656649-231656671 GGTACATGTGGAGGATGTGCAGG + Intronic
924100219 1:240595438-240595460 TGCCCAGGAGGAGGGGGTGCAGG - Intronic
1062817922 10:514618-514640 GGGCCAGGAGGAGGTGGCGAAGG - Intronic
1063624833 10:7679298-7679320 AGTCTATGTGGAGGTGGGGCAGG + Intergenic
1063960974 10:11305158-11305180 GGGCTAGGGGGAGGTGGTCCAGG + Intronic
1064043250 10:11987286-11987308 GGTCCATGTGCAGGCTGTGCAGG - Intronic
1064105379 10:12496754-12496776 GGTCCATGTGCAGGATGTGCAGG + Intronic
1064201474 10:13288506-13288528 GGTCCTGGTGCAGGGGGTGACGG + Exonic
1064217555 10:13413095-13413117 GGACCAGGAGGATGTGGTGGGGG + Intergenic
1064392998 10:14957712-14957734 GGTGGAGGTGGAGGTGGAGGTGG - Intergenic
1065023059 10:21516763-21516785 GGGCCCGGTGGTGGTGGTGGTGG + Exonic
1065484196 10:26221468-26221490 GGTGCTAGTGGTGGTGGTGCTGG + Intronic
1065838574 10:29681077-29681099 GTTCCCTGTGGAGGTGGGGCAGG + Intronic
1065845197 10:29737296-29737318 GGTCCAGGTGGAGGGGATTGGGG - Intergenic
1066025913 10:31360978-31361000 GGTTCTGGTGGAGATGGTACAGG + Intronic
1066280313 10:33910881-33910903 GGTCCATGTGCAGGATGTGCAGG + Intergenic
1067102057 10:43340987-43341009 TGTCCAGGTGGAGATGTTGGGGG + Intergenic
1067448418 10:46367032-46367054 GGACCATGTGGAGGGGGTGGGGG + Intergenic
1067541704 10:47159740-47159762 GGCCAATCTGGAGGTGGTGCTGG + Intergenic
1067588957 10:47493734-47493756 GGACCATGTGGAGGGGGTGGGGG - Intergenic
1067636083 10:48001825-48001847 GGACCATGTGGAGGGGGTGGGGG - Intergenic
1067768501 10:49107550-49107572 GGTAGAGGTGGTGGTGGGGCAGG - Intronic
1068091470 10:52437842-52437864 GATCAAGTTGGAGGTTGTGCTGG + Intergenic
1068632078 10:59308538-59308560 GGTGCTGGTGGTGGTGGTGGGGG - Intronic
1068669334 10:59708841-59708863 GGTCCAGGTGGGCGCGGTGCCGG + Intronic
1068747696 10:60553667-60553689 GGGGCAGGGGGAGGAGGTGCAGG + Intronic
1069015797 10:63427571-63427593 GTTCCAGGTGAAGGTGGTCATGG - Intronic
1069598135 10:69686110-69686132 GCTCCTGCTGGAGGTGGTTCTGG - Intronic
1069628400 10:69882091-69882113 GGTCCTGATGAAGGTGGTGATGG + Intronic
1069722162 10:70556792-70556814 GGTGAAGGAGGCGGTGGTGCTGG - Intronic
1069727676 10:70591597-70591619 GGAGAAGGTGGAGGTGGAGCTGG - Intergenic
1069896982 10:71686008-71686030 GCTCCAGGAGGAGGAGGGGCCGG + Intronic
1070132642 10:73665832-73665854 GGACCATGTGGAGGGGGTGGGGG - Intergenic
1070310178 10:75267296-75267318 GGAGCATGGGGAGGTGGTGCTGG + Intergenic
1070794344 10:79208070-79208092 GGTGGGGGTGGAGGTGGTGGGGG + Intronic
1070891268 10:79943682-79943704 TTTCCAGGTGGTGGTGCTGCTGG - Intronic
1071191754 10:83109159-83109181 GGTGCTGGTGGGGGTGGGGCTGG - Intergenic
1071303245 10:84273646-84273668 CATCCAGGTGGAGGGGATGCAGG + Intergenic
1071609042 10:87018244-87018266 GGACCATGTGGAGGGGGTGGGGG + Intergenic
1071882165 10:89911206-89911228 GGTGCTGGTGGAGGTAGGGCTGG + Intergenic
1072631969 10:97152381-97152403 GGTCCAGGTGCAGGTCACGCTGG + Intronic
1072881445 10:99233196-99233218 GGTGGTGGTGGTGGTGGTGCGGG - Intronic
1073357687 10:102869992-102870014 AGTGGAGGTGGAGGTGGTGACGG + Intronic
1073400208 10:103251053-103251075 GATCGTGGTGGAGGTGGTGATGG - Intergenic
1073400226 10:103251125-103251147 GGTGGTGGTGGAGGTGGTGGTGG - Intergenic
1073400240 10:103251173-103251195 GGTGGAGGTGGTGGTGGTGATGG - Intergenic
1073400283 10:103251348-103251370 GGTAGAGGTGAAGGTGGTGATGG - Intergenic
1073509432 10:104034145-104034167 AGCACAGGAGGAGGTGGTGCAGG - Exonic
1073921671 10:108466381-108466403 GGGGCGGGTGGAGGTGGCGCCGG + Intergenic
1074794493 10:116927825-116927847 GGTGGAGGAGGAGGTGGTGGAGG + Exonic
1074971088 10:118539634-118539656 GGTACACGTGCAGGTCGTGCAGG + Intergenic
1075343853 10:121668026-121668048 GGTCCTGGGGGAGGTGCTACAGG - Intergenic
1075420264 10:122295252-122295274 CTTCCAAGAGGAGGTGGTGCTGG + Intronic
1075593572 10:123710457-123710479 GGAGCAGGTGGAGGGGCTGCAGG + Intronic
1075616539 10:123893894-123893916 GGTTCTGATGGAGGTGGTGCAGG - Intronic
1075667291 10:124240396-124240418 AGGCCAGGTGGAGCTGGAGCCGG - Intergenic
1075725835 10:124610562-124610584 GGTGCTGGTGGAGCGGGTGCGGG + Intronic
1075725864 10:124610667-124610689 GGTGCTGGTGGAGCGGGTGCGGG + Intronic
1076041050 10:127249006-127249028 GGACCAGGGGGTGGTGGGGCAGG - Intronic
1076462425 10:130656107-130656129 CGTGCAGGTGGGGGTGGGGCGGG + Intergenic
1076462444 10:130656153-130656175 CGTGCAGGTGGGGGTGGGGCGGG + Intergenic
1076529449 10:131134855-131134877 GGGCCTGTTGGAGGTGCTGCTGG - Intronic
1076720895 10:132392465-132392487 GGTGATGGTGGAGGTGGTGGTGG + Intergenic
1076823261 10:132952598-132952620 GGTGCAGGTGCAGGTACTGCAGG + Intergenic
1076824665 10:132960840-132960862 GGGCTCGGGGGAGGTGGTGCTGG + Intergenic
1076829247 10:132985905-132985927 GGTCCAGGTGGGGGTGCAGGGGG + Intergenic
1076829286 10:132986001-132986023 GGTCCAGGTGGGGGTGCAGGGGG + Intergenic
1076858215 10:133127773-133127795 GGGCCAGGCGGAGGTGGAGCTGG - Intronic
1076858227 10:133127803-133127825 GGGCCAGGCGGAGGTGGAGCTGG - Intronic
1076858239 10:133127833-133127855 GGGCCAGGCGGAGGTGGAGCTGG - Intronic
1076858251 10:133127863-133127885 GGGCCAGGCGGAGGTGGAGCTGG - Intronic
1076880111 10:133235863-133235885 GGTTCAGGTGGAGGTGGTGGCGG + Intergenic
1077094874 11:795061-795083 GGTGGAGGTGGAGGTGGAGGAGG + Exonic
1077156241 11:1093015-1093037 GGTCGGGGTGGTGGTGGTGGTGG - Intergenic
1077435122 11:2535249-2535271 GGACCAGGGGCAGGTGGAGCAGG + Intronic
1077524434 11:3056019-3056041 GGGACGGGTGGAGATGGTGCTGG + Intronic
1077533295 11:3107262-3107284 GGTCCAGGAGGAGCTGGGGGAGG - Exonic
1077663138 11:4086714-4086736 GGTGAAGGTGGTGGTGGTGGTGG - Intronic
1077766382 11:5163751-5163773 GCTCCTGGGGGAGGTGGTTCCGG + Intronic
1077902220 11:6498569-6498591 GGTCCAGATGGAGGTGGGTTTGG - Exonic
1078025553 11:7691783-7691805 GGGAGGGGTGGAGGTGGTGCAGG + Intronic
1078073924 11:8140055-8140077 GGATCAGGTGGAGGTGCTGGAGG - Exonic
1078428282 11:11268700-11268722 GCACCTGGTGGAGGTGGTGCTGG + Intergenic
1079407336 11:20158223-20158245 GGTGGTGGTGGTGGTGGTGCTGG + Intronic
1080225045 11:29950547-29950569 GGTCATAGTGGAGGTGGTGATGG - Intergenic
1081508002 11:43738239-43738261 GGTCCATGTGCAGGATGTGCAGG + Intronic
1081569193 11:44279107-44279129 GCGCCAGGTGGAGATGCTGCAGG - Intronic
1082000094 11:47389500-47389522 GCTGGAGGTGGAGGTGGGGCTGG - Intergenic
1082048781 11:47753026-47753048 GGTCGAGGTGGAGTTGGAGGTGG + Exonic
1082082621 11:48024047-48024069 GGTCCAGGTGGGGGGCCTGCTGG - Intronic
1083258247 11:61509547-61509569 GGTCGAGGTCGAGGATGTGCAGG - Exonic
1083311370 11:61785566-61785588 GGGCCAGGTGGAGGTGGCTGTGG + Intronic
1083372373 11:62192523-62192545 GGTCCAGGCAGGGGTGGTGAAGG + Intronic
1083681086 11:64352183-64352205 GGTGCTGGAGGAGGAGGTGCGGG + Exonic
1083713815 11:64564516-64564538 GGTGCTGGTGGAGGTGGTGCTGG - Intronic
1083895751 11:65618940-65618962 GGCCCAGGTTGGGGTGGAGCAGG + Exonic
1083968059 11:66055139-66055161 AGGCCTGGTGGAGGTGGTGGGGG - Exonic
1083968357 11:66057094-66057116 GGTCCAGGTGCTGGTTGTACAGG - Intronic
1084086701 11:66858254-66858276 GGTCCAGGTTGAGGGTGTGCAGG - Exonic
1084394255 11:68898485-68898507 GGAGGAGGTGGAGGTGGAGCAGG - Intronic
1084466189 11:69324348-69324370 GGTCGTGGTGGTGGTGGTGGTGG + Intronic
1084556573 11:69879477-69879499 GGCCCAGGGGGAGGTGGGGGTGG + Intergenic
1085232936 11:74988751-74988773 GGCGAGGGTGGAGGTGGTGCCGG + Exonic
1085260246 11:75200387-75200409 GGTGAAGGTGGGGGTGGGGCAGG + Exonic
1085411072 11:76291066-76291088 CATCCAGGGGGAGGCGGTGCTGG - Intergenic
1085531193 11:77193036-77193058 GGTGATGGTGGAGGTGGTGATGG + Intronic
1086256726 11:84885747-84885769 GGTCAATGTTAAGGTGGTGCTGG - Intronic
1087159835 11:94937883-94937905 GGCACAGGAGGTGGTGGTGCAGG + Intergenic
1087363646 11:97192648-97192670 GGTACATGTGCAGGAGGTGCAGG + Intergenic
1088089673 11:106022681-106022703 GGTCGAGGAGAAGGTGATGCTGG - Intergenic
1088645555 11:111913649-111913671 GGTCCAGGCGCTGGGGGTGCCGG - Exonic
1089125722 11:116175179-116175201 GGTCGATGTGGTGGTGGTGGTGG - Intergenic
1089405838 11:118196673-118196695 GGCTCAGGTGGTGGTGGTGGTGG - Intronic
1090212848 11:124935141-124935163 GGTGCTGGTGGAGGGGGTGTTGG - Intronic
1090350538 11:126105045-126105067 GGTGCTGGTGTTGGTGGTGCCGG - Intergenic
1090567637 11:128012718-128012740 GGTACATGTGCAGGAGGTGCAGG - Intergenic
1091283211 11:134394048-134394070 GGCCCGGGAGGCGGTGGTGCTGG - Intronic
1091562449 12:1625479-1625501 GGGGCAGGTGGAGGAGGAGCAGG - Intronic
1091771328 12:3153070-3153092 GGTGGTGGTGGTGGTGGTGCAGG + Intronic
1092075282 12:5667569-5667591 GGTACATGTGGAGGACGTGCAGG + Intronic
1093079276 12:14790521-14790543 GGTCCAAGAGGTGGTGGTCCTGG + Exonic
1093172626 12:15876299-15876321 TGTTCTGGTGGAGGTGGTGGAGG - Intronic
1094132962 12:27094679-27094701 GGACCAGGTGGAGGTAGTGAAGG - Intergenic
1094182731 12:27609482-27609504 GGACAAGGTGGAGGTAGTGAAGG - Intronic
1094420818 12:30269279-30269301 AGTTCAGGTGGAGGTGGAGAGGG - Intergenic
1094428275 12:30338570-30338592 AGTCCAGGTGGAGGTGGAGAGGG + Intergenic
1096071194 12:48776394-48776416 GGTCCAGGTGGGGGGGATGGGGG - Intronic
1096198117 12:49662126-49662148 GTTCCAGGAGGAGGAGGTGTTGG - Intronic
1096385203 12:51190725-51190747 GGTCTTGGTGGAGGTGGTGAGGG - Intronic
1096492971 12:52023151-52023173 GGGACAGGTGGAGGTGCTGGGGG + Intronic
1096551795 12:52378043-52378065 GGTCCGGCAGGAGGTGGTGGTGG + Exonic
1096634272 12:52948813-52948835 CCCCCAGGTGGAGGAGGTGCTGG - Intronic
1096982441 12:55736211-55736233 GATCCTGGTGGGGGTGGGGCTGG - Intergenic
1097191143 12:57220243-57220265 GGTGGAGGTGGAGGAGGGGCAGG - Intronic
1097263739 12:57734297-57734319 GGTGAGGGTGGAGGTGGTGGGGG - Exonic
1098198944 12:68034572-68034594 GGGGCAGGTGGTGGTTGTGCCGG - Intergenic
1098234135 12:68402219-68402241 GGGCCATGTGGAGGAGGTGTGGG - Intergenic
1098588967 12:72187474-72187496 GGTCGTGGTGGTGGTGGTGGTGG + Intronic
1101340685 12:103840331-103840353 GGTCCAGGTGGGGAAGGTTCTGG - Intronic
1101411680 12:104473924-104473946 GGTCGCGGTGGTGGTGGTGGTGG - Intronic
1101521604 12:105487306-105487328 TGACCATGTGGAGGTGGTGGTGG + Intergenic
1101522507 12:105497006-105497028 GGTGATGGTGGAGGTGGTGGTGG + Intergenic
1101522508 12:105497012-105497034 GGTGGAGGTGGTGGTGGTGATGG + Intergenic
1102254562 12:111408008-111408030 GGTTCAGTTGCAGGTGGTGGTGG + Intronic
1102339383 12:112109554-112109576 GGTCCAGGAACAGGTGGTGGAGG - Intergenic
1102512641 12:113426005-113426027 GGTGGAGGTGGTGGTGGTGTTGG - Intronic
1102512642 12:113426011-113426033 GGTGGTGGTGGAGGTGGTGGTGG - Intronic
1103199875 12:119079071-119079093 GGTCCAGGAGGATGTGATGCAGG + Intronic
1103984030 12:124755263-124755285 GGTCCAGATGGACGTGGGGGTGG - Intergenic
1104055389 12:125226273-125226295 GGCCAAGGTGGAGCTGGGGCTGG - Intronic
1104252873 12:127112886-127112908 GGTGGAGGTGGAGGTGGAGATGG - Intergenic
1104252874 12:127112892-127112914 GGTGGAGGTGGAGGTGGAGGTGG - Intergenic
1104786088 12:131448683-131448705 GGTGCAGGTGTAGGCAGTGCAGG - Intergenic
1104993936 12:132642537-132642559 TGTCCAGGTTGAGGTAGTGACGG + Exonic
1105072428 12:133242858-133242880 GGCTCAGGTGGGGGTGCTGCAGG - Intergenic
1105334790 13:19457390-19457412 GGTACATGTGGAGGATGTGCAGG + Intronic
1105416662 13:20219136-20219158 TGGGCAGGTGGAGGTGGGGCAGG + Intergenic
1105860131 13:24401999-24402021 GGTACATGTGGAGGATGTGCAGG - Intergenic
1106472820 13:30072777-30072799 GCTCCAGGTGGAAGTGGGCCGGG + Intergenic
1107091873 13:36490181-36490203 TGGCCAGCTGCAGGTGGTGCAGG + Intergenic
1107566755 13:41613112-41613134 GGTGGAGGTGGGGGTGGTGATGG - Intronic
1107581706 13:41795911-41795933 GGTACATGTGCAGGAGGTGCAGG - Intronic
1107666189 13:42693550-42693572 TGTTCCGGTGGAGGTGGTGGGGG + Intergenic
1107778035 13:43867935-43867957 GGACCAGGTGGACATGGTACTGG - Intronic
1107820993 13:44285589-44285611 GGTCCATGTGCAGGATGTGCAGG + Intergenic
1107830908 13:44373475-44373497 CGTCCAGGGGGCGGCGGTGCAGG + Intergenic
1108609003 13:52065497-52065519 GGGGCAGGTGGAGGTGATGTCGG + Exonic
1109876177 13:68406499-68406521 AATCCAGGTGGAGGTGGTCTCGG - Intergenic
1110626258 13:77659436-77659458 GGTTCTGGTGGAGATGGTACAGG + Intergenic
1110627609 13:77668815-77668837 TGTTCCGGTGGAGGTGGTGGGGG - Intergenic
1111388411 13:87560974-87560996 GGTGGAGGTGGAGGTGGAGGTGG - Intergenic
1111388413 13:87560980-87561002 GGTGGAGGTGGAGGTGGAGGTGG - Intergenic
1111388415 13:87560986-87561008 GGTAGAGGTGGAGGTGGAGGTGG - Intergenic
1111392832 13:87621069-87621091 TGTCCAAGTGGAGGTGGAGGAGG - Intergenic
1111615911 13:90661423-90661445 GGTGCATGTGGAGGATGTGCAGG - Intergenic
1111668140 13:91295723-91295745 GGTGCAGGGGGAGGTTGTGGTGG - Intergenic
1111737859 13:92164795-92164817 TGTCCAGGCAGAGGTGCTGCAGG - Intronic
1112891021 13:104231680-104231702 GGTACATGTGGAGGATGTGCAGG + Intergenic
1113146374 13:107212528-107212550 GGTGAAGGTGGAGGTGGTGCCGG + Intronic
1113269889 13:108662172-108662194 TGTTCTGGTGGAGGTGGTGAAGG + Intronic
1113544455 13:111137347-111137369 GGTCCAGGTCATGGTGCTGCTGG - Intronic
1113610487 13:111641544-111641566 GGGCCTGCTGGAGGTGCTGCTGG + Intronic
1113711332 13:112467274-112467296 GCTCCTGGGGGAGGAGGTGCGGG - Intergenic
1113721815 13:112563130-112563152 GGTCCAGGTTGACGTGGAGACGG - Intronic
1113728412 13:112622745-112622767 GGGCCAGGAGGAGGTGCTCCTGG + Intergenic
1113788774 13:113016459-113016481 GGCCCACGTGGAGGGGTTGCCGG - Intronic
1113803071 13:113096442-113096464 GGACGTGGTGGAGCTGGTGCAGG + Exonic
1113835163 13:113323990-113324012 GGTACAGGTGGAGGGTGTACAGG - Intergenic
1113835492 13:113326026-113326048 GGTCCTCGGGGAGCTGGTGCGGG - Exonic
1114318053 14:21525234-21525256 GGTGGAGGAGGAGGGGGTGCAGG + Exonic
1114595829 14:23910849-23910871 GGACCAGGTGAAGGAGGTGTGGG - Intergenic
1114707112 14:24738307-24738329 GGTCCAGGCTGAGGTGGTCCAGG - Intergenic
1114933601 14:27506514-27506536 GGTCCAGTTGGTGGTGCTGTTGG + Intergenic
1115028375 14:28767414-28767436 GGTGGTGGTGGTGGTGGTGCTGG - Exonic
1115529460 14:34313971-34313993 TGTCCAGTGGCAGGTGGTGCTGG + Intronic
1115747189 14:36449731-36449753 GGCACAGGTGGGAGTGGTGCTGG + Intergenic
1116941308 14:50793728-50793750 GGTGGAGGTGGTGGTGGTGGTGG - Intronic
1117141052 14:52791521-52791543 GGTGGAGGAGGAGGTGGGGCTGG - Exonic
1117181861 14:53199837-53199859 GGTCCAGGGTGAGGTGGTCTCGG + Intergenic
1117261354 14:54037286-54037308 GGTACAGGTGCAGGATGTGCAGG + Intergenic
1117677529 14:58170136-58170158 GGTGGAGGTGGAGGTGGGGCTGG - Intronic
1117790075 14:59331299-59331321 GGTAGAGGTGGGGGTGGTGGGGG - Exonic
1117801184 14:59446301-59446323 GCTCCTGGGGGAGGTGGTTCTGG - Intronic
1118310116 14:64685896-64685918 GGTGCAGCTGGAGGTGGAGATGG - Intergenic
1118732595 14:68678907-68678929 TGTGAAGGTGGAGGTGGAGCTGG - Intronic
1118908417 14:70040872-70040894 GGTCCAGGTGGGGAAGGTGAGGG - Intergenic
1119407485 14:74407634-74407656 GGCCCGGCGGGAGGTGGTGCTGG + Exonic
1119434185 14:74587134-74587156 GGTCCTGGTGGGGGAGGGGCCGG - Intronic
1119461614 14:74809503-74809525 GGTAGAGGTGGAGGAGGTGGAGG - Exonic
1120873819 14:89360709-89360731 GGTGGTGGTGGAGGTAGTGCTGG - Intronic
1120873826 14:89360736-89360758 GGTGGTGGTGGAGGTGGTGCTGG - Intronic
1120873829 14:89360748-89360770 GGTAGTGGTGGAGGTGGTGGTGG - Intronic
1120873837 14:89360775-89360797 GGTGGTGGTGGAGGTGGTGGTGG - Intronic
1120873846 14:89360802-89360824 GGTGGTGGTGGAGGTGGTGCTGG - Intronic
1120873849 14:89360814-89360836 GGTAGTGGTGGAGGTGGTGGTGG - Intronic
1120873857 14:89360841-89360863 GGTGGTGGTGGAGGTGGTGCTGG - Intronic
1120873860 14:89360853-89360875 GGTGGTGGTGGAGGTGGTGGTGG - Intronic
1120873864 14:89360865-89360887 GGTGGTGGTGGAGGTGGTGGTGG - Intronic
1120873868 14:89360877-89360899 GGTGGTGGTGGAGGTGGTGGTGG - Intronic
1120873871 14:89360886-89360908 GGTGGAGGTGGTGGTGGTGGAGG - Intronic
1120873873 14:89360892-89360914 GGTGGTGGTGGAGGTGGTGGTGG - Intronic
1120873882 14:89360919-89360941 GGTGGTGGTGGAGGTGGTGCTGG - Intronic
1120873884 14:89360928-89360950 GGTGGAGGTGGTGGTGGTGGAGG - Intronic
1120873886 14:89360934-89360956 GGTGGTGGTGGAGGTGGTGGTGG - Intronic
1120873895 14:89360961-89360983 GGTAGTGGTGGAGGTGGTGCTGG - Intronic
1120873902 14:89360988-89361010 GGTGGTGGTGGAGGTGGTGCTGG - Intronic
1120873905 14:89361000-89361022 GGTGGTGGTGGAGGTGGTGGTGG - Intronic
1120873909 14:89361012-89361034 GGTGGTGGTGGAGGTGGTGGTGG - Intronic
1120873913 14:89361024-89361046 GGTGGTGGTGGAGGTGGTGGTGG - Intronic
1120873924 14:89361063-89361085 GGTGGTGGTGGAGGTGGTGCTGG - Intronic
1120873932 14:89361090-89361112 GGTGGTGGTGGTGGTGGTGCTGG - Intronic
1120873933 14:89361096-89361118 GGTGGAGGTGGTGGTGGTGGTGG - Intronic
1120873935 14:89361102-89361124 GGTAGTGGTGGAGGTGGTGGTGG - Intronic
1120873943 14:89361129-89361151 GGTGGTGGTGGAGGTGGTGCTGG - Intronic
1120873953 14:89361168-89361190 GGTGGTGGTGGAGGTGGTGCTGG - Intronic
1120873963 14:89361204-89361226 GGTGGTGGTGGAGGTGGTGGTGG - Intronic
1120873966 14:89361213-89361235 GGTGGAGGTGGTGGTGGTGGAGG - Intronic
1120873968 14:89361219-89361241 GGTGGTGGTGGAGGTGGTGGTGG - Intronic
1120873977 14:89361246-89361268 GGTGGTGGTGGAGGTGGTGCTGG - Intronic
1120873980 14:89361258-89361280 GGTGGAGGTGGTGGTGGTGGTGG - Intronic
1120873982 14:89361264-89361286 GGTGGTGGTGGAGGTGGTGGTGG - Intronic
1120873991 14:89361291-89361313 GGTGGTGGTGGAGGTGGTGCTGG - Intronic
1120873999 14:89361318-89361340 GGTGGTGGTGGAGGTGGTGCTGG - Intronic
1120874007 14:89361345-89361367 GGTGGTGGTGGAGGTGGTGCTGG - Intronic
1120874014 14:89361369-89361391 GGTGGTGGTGGAGGTGGTGCTGG - Intronic
1120874022 14:89361396-89361418 GGTGGTGGTGGAGGTGGTGCTGG - Intronic
1120874024 14:89361405-89361427 GGTGGAGGTGGTGGTGGTGGAGG - Intronic
1120874026 14:89361411-89361433 GGTGGTGGTGGAGGTGGTGGTGG - Intronic
1120874038 14:89361451-89361473 GGTGGTGGTGGAGGTGGTGCTGG - Intronic
1120874046 14:89361478-89361500 GGTGGTGGTGGAGGTGGTGCTGG - Intronic
1120874049 14:89361490-89361512 GGTAGTGGTGGAGGTGGTGGTGG - Intronic
1120874057 14:89361517-89361539 GGTGGTGGTGGAGGTGGTGGTGG - Intronic
1120874066 14:89361544-89361566 GGTGGTGGTGGAGGTGGTGCTGG - Intronic
1120874069 14:89361556-89361578 GGTGGTGGTGGAGGTGGTGGTGG - Intronic
1120874073 14:89361568-89361590 GGTAGTGGTGGAGGTGGTGGTGG - Intronic
1120874081 14:89361595-89361617 GGTGGTGGTGGAGGTAGTGCTGG - Intronic
1120874082 14:89361604-89361626 GGTGGAGGTGGTGGTGGTGGAGG - Intronic
1120874084 14:89361610-89361632 GGTGGTGGTGGAGGTGGTGGTGG - Intronic
1120874088 14:89361622-89361644 GGTGGTGGTGGAGGTGGTGGTGG - Intronic
1120874092 14:89361634-89361656 GGTGGTGGTGGAGGTGGTGGTGG - Intronic
1120874101 14:89361661-89361683 GGTGGTGGTGGAGGTGGTGCTGG - Intronic
1120874104 14:89361673-89361695 GGTGGTGGTGGAGGTGGTGGTGG - Intronic
1120874108 14:89361685-89361707 GGTAGTGGTGGAGGTGGTGGTGG - Intronic
1120874116 14:89361712-89361734 GGTGGTGGTGGAGGTAGTGCTGG - Intronic
1120874117 14:89361721-89361743 GGTGGAGGTGGTGGTGGTGGAGG - Intronic
1120874119 14:89361727-89361749 GGTGGTGGTGGAGGTGGTGGTGG - Intronic
1120874123 14:89361739-89361761 GGTGGTGGTGGAGGTGGTGGTGG - Intronic
1120874127 14:89361751-89361773 GGTGGTGGTGGAGGTGGTGGTGG - Intronic
1120874139 14:89361790-89361812 GGTGGAGGTGGTGGTGGTGGAGG - Intronic
1120874141 14:89361796-89361818 GGTGGTGGTGGAGGTGGTGGTGG - Intronic
1120874145 14:89361808-89361830 GGTGGTGGTGGAGGTGGTGGTGG - Intronic
1120874149 14:89361820-89361842 GGTAGTGGTGGAGGTGGTGGTGG - Intronic
1120874157 14:89361847-89361869 GGTGGTGGTGGAGGTAGTGCTGG - Intronic
1120874164 14:89361874-89361896 GGTGGTGGTGGAGGTGGTGCTGG - Intronic
1120874167 14:89361886-89361908 GGTAGTGGTGGAGGTGGTGGTGG - Intronic
1120874175 14:89361913-89361935 GGTGCTGGAGGTGGTGGTGCTGG - Intronic
1120874179 14:89361928-89361950 GGTAGTGGTGGAGGTGGTGCTGG - Intronic
1120874186 14:89361955-89361977 GGTGGTGGTGGAGGTGGTGCTGG - Intronic
1120874189 14:89361967-89361989 GGTAGTGGTGGAGGTGGTGGTGG - Intronic
1120874197 14:89361994-89362016 GGTGGTGGTGGAGGTGGTGCTGG - Intronic
1120874200 14:89362006-89362028 GGTAGTGGTGGAGGTGGTGGTGG - Intronic
1120874212 14:89362048-89362070 GGTAGTGGTGGAGGTGGTGGTGG - Intronic
1120874220 14:89362075-89362097 GGTAGTGGTGGAGGTGGTGCTGG - Intronic
1120874227 14:89362102-89362124 GGTGGTGGTGGAGGTGGTGCTGG - Intronic
1120874230 14:89362114-89362136 GGTAGTGGTGGAGGTGGTGGTGG - Intronic
1120874238 14:89362141-89362163 GGTGGTGGTGGAGGTGGTGCTGG - Intronic
1120874246 14:89362168-89362190 GGTGGTGGTGGAGGTGGTGCTGG - Intronic
1120874249 14:89362180-89362202 GGTAGTGGTGGAGGTGGTGGTGG - Intronic
1120874257 14:89362207-89362229 GGTGCTGGAGGTGGTGGTGCTGG - Intronic
1120874261 14:89362222-89362244 GGTGGTGGTGGAGGTGGTGCTGG - Intronic
1120874269 14:89362249-89362271 GGAGGAGGTGGTGGTGGTGCTGG - Intronic
1120874276 14:89362273-89362295 GGTGGAGGTGGTGGTGGTGGAGG - Intronic
1120874278 14:89362279-89362301 GGTGGTGGTGGAGGTGGTGGTGG - Intronic
1120874289 14:89362312-89362334 GGTGGTGGTAGAGGTGGTGCTGG - Intronic
1120874296 14:89362339-89362361 GGAGGAGGTGGTGGTGGTGCTGG - Intronic
1120874305 14:89362369-89362391 GGTGGTGGTGGAGGTGGTGGTGG - Intronic
1120874314 14:89362396-89362418 GGAGGAGGTGGTGGTGGTGCTGG - Intronic
1120874356 14:89362546-89362568 GGTGGTGGTGGAGGTGGTGGTGG - Intronic
1120874427 14:89362795-89362817 GGTGGTGGTGGAGGTGGTGGTGG - Intronic
1121715909 14:96074150-96074172 GGTCCATGTGCAGAAGGTGCAGG - Intronic
1122066218 14:99175857-99175879 GGTCCAGGTGGTGGCGCGGCGGG + Exonic
1122176947 14:99927944-99927966 GGTGGTGGTGGAGGTGGTGGTGG + Intronic
1122176962 14:99927995-99928017 GGTGGTGGTGGAGGTGGTGGTGG + Intronic
1122176964 14:99928001-99928023 GGTGGAGGTGGTGGTGGTGGTGG + Intronic
1122176991 14:99928094-99928116 GGTGGTGGTGGAGGTGGTGGTGG + Intronic
1122176993 14:99928100-99928122 GGTGGAGGTGGTGGTGGTGGTGG + Intronic
1122176997 14:99928112-99928134 GGTGGTGGTGGAGGTGGTGGTGG + Intronic
1122176999 14:99928118-99928140 GGTGGAGGTGGTGGTGGTGGTGG + Intronic
1122177013 14:99928163-99928185 GGTGGTGGTGGAGGTGGTGGTGG + Intronic
1122177015 14:99928169-99928191 GGTGGAGGTGGTGGTGGTGGTGG + Intronic
1122322087 14:100861282-100861304 TGTACAGGAGGAGGTGGTGGTGG + Intergenic
1122342704 14:101038586-101038608 GGTACTGGTGGTGGTGGTGGTGG + Intergenic
1122632370 14:103112793-103112815 GGTGCCGGTGGGGGTGGGGCTGG + Intergenic
1122769913 14:104093308-104093330 GCTCCAGGTGGAAGGGGGGCCGG + Intronic
1122771012 14:104097648-104097670 GGTGCACGTGGAGGCGGGGCAGG + Intronic
1122907094 14:104806633-104806655 GGTAGAGGTGGAGGTGATGGTGG - Intergenic
1123021368 14:105399270-105399292 GGAGCAGGGGGAGGTGGGGCGGG - Intronic
1202852341 14_GL000225v1_random:29771-29793 GGTGATGGTGGAGGTGGGGCCGG - Intergenic
1124467015 15:29949125-29949147 GGTGAAGGTGGAGGTGGAGGTGG - Intronic
1124467037 15:29949206-29949228 GGTGAAAGTGGAGGTGGTGGTGG - Intronic
1124467042 15:29949227-29949249 GGTGAAGGTGGAGGTAGTGGTGG - Intronic
1124467062 15:29949299-29949321 GGTGAAAGTGGAGGTGGTGGTGG - Intronic
1124467069 15:29949329-29949351 GGTGGTGGTGGAGGTGGTGGAGG - Intronic
1124467072 15:29949338-29949360 GGTGGAGGTGGTGGTGGTGGAGG - Intronic
1124467074 15:29949344-29949366 GGTTGTGGTGGAGGTGGTGGTGG - Intronic
1124467095 15:29949431-29949453 GGTGAAGGTGGAGGTGGAGGTGG - Intronic
1124467119 15:29949515-29949537 GGTGGAGGTGGTGGTGGTGGAGG - Intronic
1124467121 15:29949521-29949543 GGTGGTGGTGGAGGTGGTGGTGG - Intronic
1124467146 15:29949608-29949630 GGTGGAGGTGGTGGTGGTGAAGG - Intronic
1124467147 15:29949614-29949636 GGTGGAGGTGGAGGTGGTGGTGG - Intronic
1124467152 15:29949629-29949651 GGTGGTGGTGGAGGTGGTGGAGG - Intronic
1124467155 15:29949638-29949660 GGTGGAGGTGGTGGTGGTGGAGG - Intronic
1124467157 15:29949644-29949666 TGTGGAGGTGGAGGTGGTGGTGG - Intronic
1124467184 15:29949737-29949759 GGTGAAAGTGGAGGTGGTGGTGG - Intronic
1124467191 15:29949767-29949789 GGTGGTGGTGGAGGTGGTGGAGG - Intronic
1124467194 15:29949776-29949798 GGTGGAGGTGGTGGTGGTGGAGG - Intronic
1124467196 15:29949782-29949804 GGTTGTGGTGGAGGTGGTGGTGG - Intronic
1124467228 15:29949905-29949927 GGTGAAGGTGGAGGTGGAGGTGG - Intronic
1124467241 15:29949950-29949972 GGTTGTGGTGGAGGTGGTGGTGG - Intronic
1124467258 15:29950013-29950035 GGTGAAGGTGGAGGTGGAGGTGG - Intronic
1124467266 15:29950040-29950062 GGTGGAGGTGGTGGTGGTGGAGG - Intronic
1124467268 15:29950046-29950068 GGTGGTGGTGGAGGTGGTGGTGG - Intronic
1124467271 15:29950055-29950077 GGTGGAGGTGGTGGTGGTGGAGG - Intronic
1124467273 15:29950061-29950083 GGTGGTGGTGGAGGTGGTGGTGG - Intronic
1124467369 15:29950447-29950469 GGTGGAGGTGGAGTTGGTGGTGG - Intronic
1124467371 15:29950453-29950475 GGTCATGGTGGAGGTGGAGTTGG - Intronic
1124684627 15:31771653-31771675 GGTCAGGGTGGAGGTGGAGATGG - Intronic
1124940647 15:34214326-34214348 GTTGCTGGTGGAGGTGGTGGGGG + Intergenic
1125035729 15:35121784-35121806 GTTCCAGGTGAAGGTGGTCATGG + Intergenic
1125085220 15:35721850-35721872 AGTCTAGGAGGAGTTGGTGCTGG + Intergenic
1125579255 15:40774089-40774111 GGTGCAGGTGGAGGGTGTGAAGG + Intronic
1126102580 15:45128983-45129005 GGTCCGGGTGTGGGTGGTGGGGG - Intronic
1126144264 15:45462094-45462116 GGTCGTGGTGGTGGTGGTGATGG - Intergenic
1126332478 15:47548366-47548388 GTTCCAGGGGGAGGTGTTTCTGG - Intronic
1126849679 15:52789476-52789498 GGTGCGGGTGGTGGTGGTGATGG + Exonic
1128219548 15:65958550-65958572 GTTCCAGCTGGAAGTGGCGCAGG - Intronic
1128241396 15:66103648-66103670 GGTCAAGGTGGGGGTGGTCAGGG + Intronic
1128345245 15:66849118-66849140 GCACCTGGTGGAGGTGGAGCTGG - Intergenic
1128512975 15:68325069-68325091 GGTTGAGGTGGAGGTGGGGGTGG + Intronic
1128803047 15:70509243-70509265 GGCCCAGGAGGAGCTGGTGTAGG + Intergenic
1130459872 15:84152899-84152921 TGGGCAGGTGGAGGTGGCGCAGG - Intergenic
1130484678 15:84392126-84392148 GGACAAGGTGGAGGAGCTGCTGG + Intergenic
1130794641 15:87195511-87195533 GGGCCAGGTGGGGGTGGTTGGGG + Intergenic
1131172926 15:90191196-90191218 GGCCCCAGTGGGGGTGGTGCTGG + Intronic
1131356201 15:91749270-91749292 GGTGGAGGTGGAGGTGGTAGAGG + Intergenic
1131356206 15:91749285-91749307 GGTAGAGGTGGAGGTGGAGGTGG + Intergenic
1131356208 15:91749291-91749313 GGTGGAGGTGGAGGTGGAGGTGG + Intergenic
1131356209 15:91749297-91749319 GGTGGAGGTGGAGGTGGTAGAGG + Intergenic
1131356214 15:91749312-91749334 GGTAGAGGTGGAGGTGGTGGTGG + Intergenic
1131356226 15:91749351-91749373 GGTGGAGGTGGAGGTGGTGGTGG + Intergenic
1131356250 15:91749444-91749466 GGTGGAGGTGGAGGTGGTGGAGG + Intergenic
1131356255 15:91749459-91749481 GGTGGAGGTGGAGGTGGTGGTGG + Intergenic
1131356257 15:91749465-91749487 GGTGGAGGTGGTGGTGGTGGAGG + Intergenic
1131356266 15:91749501-91749523 GGTGGAGATGGAGGTGGTGGTGG + Intergenic
1131356277 15:91749528-91749550 GGTGGAGGTGGAGGTGGAGGTGG + Intergenic
1131356279 15:91749534-91749556 GGTGGAGGTGGAGGTGGTGGTGG + Intergenic
1131356281 15:91749540-91749562 GGTGGAGGTGGTGGTGGTGGAGG + Intergenic
1131356289 15:91749576-91749598 GGTAGAGATGGAGGTGGTGGTGG + Intergenic
1131356315 15:91749675-91749697 GGTGGAGGTGGAGGTGGTAGAGG + Intergenic
1131356320 15:91749690-91749712 GGTAGAGGTGGAGGTGGAGGTGG + Intergenic
1131356321 15:91749696-91749718 GGTGGAGGTGGAGGTGGTAGAGG + Intergenic
1131356325 15:91749711-91749733 GGTAGAGGTGCAGGTGGTGGTGG + Intergenic
1131356327 15:91749717-91749739 GGTGCAGGTGGTGGTGGAGGTGG + Intergenic
1131356336 15:91749750-91749772 GGTGGAGATGGAGGTGGTGGTGG + Intergenic
1131356353 15:91749810-91749832 GGTAGAGGTGGAGGTGGTGGAGG + Intergenic
1131356357 15:91749825-91749847 GGTGGAGGTGGAGGTGGAGATGG + Intergenic
1131356367 15:91749864-91749886 GGTAGAGGTGGAGGTGGTAGAGG + Intergenic
1131356372 15:91749879-91749901 GGTAGAGGTGGAGGTGGAGGTGG + Intergenic
1131356373 15:91749885-91749907 GGTGGAGGTGGAGGTGGTAGAGG + Intergenic
1131356378 15:91749900-91749922 GGTAGAGGTGGAGGTGGTGGTGG + Intergenic
1131356391 15:91749945-91749967 GATGGAGGTGGAGGTGGTGGAGG + Intergenic
1131356431 15:91750098-91750120 GGTGGAGATGGAGGTGGTGGTGG + Intergenic
1131356542 15:91750622-91750644 GGTGGAGGTGGTGGTGGTGGTGG + Intergenic
1131356550 15:91750649-91750671 GGTCGTGGTGGTGGTGGTGGTGG + Intergenic
1131675554 15:94667149-94667171 GGTTGAAGTGGAGGTGGTGGTGG - Intergenic
1131685257 15:94760480-94760502 GGTATAAGTGGAGGTGGGGCAGG - Intergenic
1132291934 15:100710038-100710060 GATGGAGGTGGAGGTGGTGTTGG + Intergenic
1132291984 15:100710340-100710362 GGTGGAGGTGGAGGTGGAGGTGG + Intergenic
1132291992 15:100710370-100710392 GATGGAGGTGGAGGTGGTGGTGG + Intergenic
1132291999 15:100710394-100710416 GGTCATGGTGGAGGTGGAGGTGG + Intergenic
1132292001 15:100710400-100710422 GGTGGAGGTGGAGGTGGAGGTGG + Intergenic
1132292008 15:100710424-100710446 GGTCATGGTGGAGGTGGAGGTGG + Intergenic
1132292010 15:100710430-100710452 GGTGGAGGTGGAGGTGGAGGTGG + Intergenic
1132594760 16:743658-743680 GCTCCGGGTGGAGCTGGGGCGGG + Intronic
1132672231 16:1106613-1106635 GGTGGAGGTGGAGGGGGTGGGGG - Intergenic
1132809783 16:1792027-1792049 GCTCCAGGTGCAGGTGGCACAGG + Exonic
1132862627 16:2079107-2079129 GCTCCAGGTGGAGGTTTTTCAGG - Exonic
1132967802 16:2668940-2668962 GGTGTAGGTGGAAGTGGTGCAGG + Intergenic
1133040582 16:3058266-3058288 CGCCCAGGTGAGGGTGGTGCAGG + Exonic
1133235948 16:4387524-4387546 GGTGGAGGTGGAGGTGGAGGTGG - Intronic
1133235950 16:4387530-4387552 GGTGGAGGTGGAGGTGGAGGTGG - Intronic
1133307464 16:4819650-4819672 GGTCAAAGTGGAGGAGCTGCCGG - Intronic
1133449165 16:5889117-5889139 GGTCCATGTGTAGGATGTGCAGG + Intergenic
1134107492 16:11494485-11494507 GCTCCAGGTGGAGAGGGTGGGGG - Intronic
1134300891 16:12989802-12989824 GGTCCATGTGTAGGATGTGCAGG + Intronic
1134539967 16:15056114-15056136 AGTCCAGGCGGAGGCGGTGCCGG + Intronic
1134620541 16:15685763-15685785 GTTCTAGGTGGAGGAGGAGCTGG + Intronic
1135422271 16:22313438-22313460 AGGCCAGGTGGAGGTGGGGATGG + Intronic
1135848281 16:25939139-25939161 GGGCCAGGTGGGGATGGTGGTGG + Intronic
1136294475 16:29293685-29293707 AGTCCAGGAGGAGGCTGTGCTGG + Intergenic
1136419504 16:30123119-30123141 GGTCCCGGGGGAGGTGGAGATGG - Exonic
1136512794 16:30749120-30749142 GGTGCTGGTGGTGGTGGTGCTGG + Intronic
1136512802 16:30749153-30749175 GGTGCTGGTGGTGGTGGTGCTGG + Intronic
1136512818 16:30749239-30749261 GGTGCTGGTGCTGGTGGTGCTGG + Intronic
1136585879 16:31184372-31184394 GGTGGAGGTGGAGGTGGAGGTGG + Exonic
1137440997 16:48498383-48498405 CGTCCAGGTGCAGCTGGAGCTGG + Intergenic
1137697009 16:50468288-50468310 GGCCCGGGTGGGGGTGGGGCGGG + Intergenic
1138432559 16:56978264-56978286 GGTGCAGGGAGAGGTGGTGGTGG + Intronic
1138552913 16:57757067-57757089 CGTCCTGGAGGAGGTGATGCTGG + Exonic
1138829070 16:60357237-60357259 GGTTCTGGTGGAGATGGTACAGG + Intergenic
1139332319 16:66202944-66202966 AGGACAGGTGGAGGTGGTGGTGG - Intergenic
1139358324 16:66380710-66380732 GGACAAGGTGGTGGTGGTGGTGG + Intronic
1139387089 16:66579644-66579666 GGTGGAGGTGGAGCTGGTGCTGG - Exonic
1139387093 16:66579650-66579672 GCCCCGGGTGGAGGTGGAGCTGG - Exonic
1139475156 16:67199380-67199402 GGTCCAGCTGGATGAGCTGCGGG - Exonic
1139545734 16:67648718-67648740 GGTCCAGGTGCAGGTCGCGGAGG - Exonic
1140139410 16:72240973-72240995 GGTGCAGGTGGAGGGGGTTAAGG + Intergenic
1140188734 16:72796545-72796567 GGTGGAGGGGGAGGTGGTGGTGG + Exonic
1140209147 16:72957598-72957620 GGCCCAGGTGGCGGTTGTGTTGG + Exonic
1140859508 16:79006674-79006696 GATCCAGGTGTAGGTGGGGCTGG + Intronic
1140908187 16:79428207-79428229 GCTGCAGGTGGAGGAGGTGAGGG - Intergenic
1141314617 16:82950136-82950158 GGTCAAGGTGTAGGTAGGGCTGG + Intronic
1141395752 16:83702919-83702941 GATGCATGTGGAGGTGGGGCAGG + Intronic
1141426304 16:83946699-83946721 GCTCCAGGGGGTGGGGGTGCAGG - Intronic
1141435625 16:83998198-83998220 GGACCAGCTGCAGGTGCTGCCGG - Exonic
1141625330 16:85258551-85258573 CCTCCAGGTGGAGGGGGAGCTGG + Intergenic
1141930259 16:87197467-87197489 GGTCCAGTTGTAGTTGGTCCAGG + Intronic
1142064544 16:88053666-88053688 GGTAGAGGTGGTGGTGGTGGTGG - Intronic
1142100630 16:88269121-88269143 GGAGCAGGTGAAGGTGGGGCAGG + Intergenic
1142183159 16:88681445-88681467 GGGGCAGGTTGAGGTGGTTCAGG + Exonic
1142191463 16:88720115-88720137 CTTCCAGGTGGCGCTGGTGCTGG - Exonic
1142412515 16:89923732-89923754 AGGCCCGGTGGAGGGGGTGCAGG - Intronic
1142423402 16:89987365-89987387 TGGCCAGGTGGAGGAGGTGGAGG + Intergenic
1142670561 17:1485807-1485829 GGCCCGGGTGGGGGCGGTGCGGG - Intronic
1142867369 17:2798938-2798960 GGTCAAGGTGGAGTCGGCGCTGG - Intronic
1142987669 17:3706570-3706592 GCTCCAGGTGGTGGTGATGTGGG - Intergenic
1143338889 17:6194035-6194057 GGTGCTGATGGAGGTGGTGGTGG + Intergenic
1143338915 17:6194125-6194147 GGTGGTGGTGGAGGTGGTGGTGG + Intergenic
1143338916 17:6194131-6194153 GGTGGAGGTGGTGGTGGTGATGG + Intergenic
1143481113 17:7227859-7227881 GGTCCAGGCAGAGGTGGAACAGG - Intronic
1143770610 17:9166192-9166214 GGTGCTGGTGGTGGTGGTGGTGG - Intronic
1143950973 17:10631902-10631924 GGCCGAGGTGGAGGAGCTGCGGG - Exonic
1143978326 17:10846553-10846575 GGTGGAGATGGAGGTGGTGGTGG + Intergenic
1144079239 17:11747558-11747580 GGTCCAGCTGGAGGAGCTCCTGG + Exonic
1144432479 17:15206895-15206917 GGTACATGTGGAGGATGTGCAGG - Intergenic
1144457259 17:15429454-15429476 GGTGGAGATGGAGGTGGTGGTGG + Intergenic
1144778272 17:17795651-17795673 GGAGGAGGTGGAGGAGGTGCTGG + Exonic
1146225838 17:31065520-31065542 GGACCAGGTTGACGTGGTTCTGG - Intergenic
1146603429 17:34237784-34237806 GGTCAATGTGGTGCTGGTGCTGG + Intergenic
1147153987 17:38533975-38533997 TTTCCAGGTGGTGGTGGTGGTGG - Intronic
1147185588 17:38711558-38711580 GGCCCAGGTGGAGGTGAGACTGG - Intronic
1147300741 17:39524828-39524850 GGAGCAGGCTGAGGTGGTGCTGG - Exonic
1147322116 17:39652868-39652890 GGTCCAGGCAGAGATGGTGGTGG + Intronic
1147400610 17:40178167-40178189 GCTGCAGCTGGAGGAGGTGCCGG + Intronic
1147411544 17:40256475-40256497 GGACCAGGTGGGGGTGGCGGGGG - Exonic
1147453562 17:40520838-40520860 AATCCAGTTGGAGGGGGTGCTGG + Intergenic
1147575782 17:41598404-41598426 GGTGGTGGTGGTGGTGGTGCAGG + Intergenic
1148083550 17:44980642-44980664 GCTCCAGCTGGGGGTGGTGCTGG - Intergenic
1148157298 17:45431583-45431605 GGTCCAAGGGGAGGGGGCGCCGG - Intronic
1148382026 17:47206891-47206913 GATGCAGGTGGAGGTGGAGAAGG + Intronic
1148551291 17:48552097-48552119 GGTGAGGGTGGAGTTGGTGCCGG + Exonic
1148970154 17:51472851-51472873 GGGGCTGGTGGAGGTGGGGCAGG + Intergenic
1149240974 17:54648598-54648620 GGTCCAGGGGAAGGTGGGGATGG + Intergenic
1150132117 17:62674929-62674951 GGTCCAGGTGGGTGTGGTAGGGG - Intronic
1150148678 17:62792529-62792551 GGTGCAGGTGGTGGTGGTGATGG - Intronic
1150148753 17:62792832-62792854 GGTGGTGGTGGAGGTGGTGGTGG - Intronic
1150148848 17:62793226-62793248 GGTGGTGGTGGAGGTGGTGGTGG - Intronic
1150148870 17:62793303-62793325 GGTGGAGGTGGTGGTGGTGATGG - Intronic
1150148871 17:62793309-62793331 GGTGGTGGTGGAGGTGGTGGTGG - Intronic
1150148931 17:62793553-62793575 GGTGGTGGTGGAGGTGGTGGTGG - Intronic
1150148985 17:62793762-62793784 GGTGCTGATGGAGGTGGTGGTGG - Intronic
1150149034 17:62793986-62794008 GGTCATGATGGAGGTGGTGGTGG - Intronic
1151250261 17:72828761-72828783 GGTCCAGGTGCTGCTGGAGCAGG + Intronic
1151584718 17:75002091-75002113 GGCTCAGGTGGAGGAGCTGCAGG + Exonic
1151961000 17:77405603-77405625 AGTCCAGGTGGAGGAAATGCAGG + Intronic
1152334545 17:79693032-79693054 GGTCCAGATGGAGGCGATGCAGG + Intergenic
1152441753 17:80313910-80313932 GGTGATGGTGGAGGTGGTGGAGG + Intronic
1152441785 17:80314036-80314058 GGTGATGGTGGAGGTGGTGGAGG + Intronic
1152442215 17:80315792-80315814 GGTGGTGGTGGAGGTGGTGGTGG + Intronic
1152442217 17:80315798-80315820 GGTGGAGGTGGTGGTGGTGGTGG + Intronic
1152557016 17:81058494-81058516 GGCCCACGTGGTGGTGCTGCAGG + Intronic
1152622633 17:81372894-81372916 GGTCCAAGTGGAGGGGATGCAGG - Intergenic
1152891668 17:82885130-82885152 GGACCAGGTGGAAGGGGTGCTGG + Intronic
1152891689 17:82885204-82885226 GGACCAGGCGGAAGGGGTGCTGG + Intronic
1152938792 17:83154974-83154996 GGTCTATGGGGAGGTGGAGCTGG - Intergenic
1152938807 17:83155023-83155045 GGTCTATGGGGAGGTGGAGCTGG - Intergenic
1152938838 17:83155122-83155144 GGTCTATGGGGAGGTGGAGCTGG - Intergenic
1153805418 18:8705723-8705745 GGTGGTGGTGGCGGTGGTGCTGG - Intronic
1154032777 18:10767798-10767820 AGTCCAGGAGGAGAAGGTGCTGG + Intronic
1154303126 18:13212212-13212234 GGTCCATGTGCAGGACGTGCAGG + Intergenic
1155524236 18:26700249-26700271 ATTTCAGGTGGGGGTGGTGCAGG + Intergenic
1156048172 18:32900616-32900638 GGGCCAAGTGGATGGGGTGCAGG + Intergenic
1156337370 18:36183632-36183654 GGTCCTGGAGGAGGAGGTGGGGG - Intergenic
1156924053 18:42555954-42555976 GCTCCAGGGGGAGGAGGTTCTGG + Intergenic
1156938531 18:42738898-42738920 GCTCCAGGGGGAGGAGGTTCTGG - Intergenic
1157102889 18:44745824-44745846 GCTCCTGGAGGAGGTGGTGCAGG + Intronic
1157206827 18:45707762-45707784 GGTGATGGTGGAGGTGGAGCTGG + Intergenic
1157206829 18:45707768-45707790 GGTGGAGGTGGAGCTGGTGGTGG + Intergenic
1157331100 18:46704520-46704542 GGAGCATGTGGAGGTGGGGCAGG - Intronic
1157565398 18:48676020-48676042 GGTCCTGGGGGAGGGGGTGCCGG - Intronic
1158002659 18:52636916-52636938 GGTGGAGGTGGCGGGGGTGCAGG - Intronic
1158331462 18:56367755-56367777 TGTTCTGGTGGAGGTGGTGGAGG + Intergenic
1158676446 18:59523795-59523817 GGCCCAGGGGGAGGAGATGCAGG - Intronic
1158894635 18:61901366-61901388 GGTCCACTTGGATGAGGTGCAGG - Intergenic
1159491071 18:69135234-69135256 GGTACAGGTGCAGGATGTGCAGG + Intergenic
1159538825 18:69749270-69749292 GGTACAGGTGCAGGATGTGCAGG - Intronic
1160257321 18:77258808-77258830 GGTCATAGTGGTGGTGGTGCTGG + Intronic
1160326849 18:77957860-77957882 GGTGCTGGTGGTGGTGGTGTTGG - Intergenic
1160326916 18:77958172-77958194 GGTGCTGGTGGTGGTGGTGTTGG - Intergenic
1160326952 18:77958345-77958367 GGTGTTGGTGAAGGTGGTGCTGG - Intergenic
1160463861 18:79059408-79059430 GGTCCAGTGGGAGAGGGTGCTGG - Intergenic
1160496975 18:79381484-79381506 GACCCAGGTAGAGGTGGGGCTGG - Intergenic
1160535065 18:79587237-79587259 AGTCCTGATGGAGGTGGTGGAGG + Intergenic
1160562864 18:79770549-79770571 GGTCCAGAGGGAGGAGGTGCGGG + Intergenic
1160703223 19:518033-518055 GGCCCAGGCTGAGGGGGTGCTGG + Intronic
1160752374 19:740501-740523 GGCCCAGGTGGAGGGAGGGCAGG - Intronic
1160971287 19:1768874-1768896 GGTAGAGGTGGAGGTGGTGGAGG + Intronic
1160971292 19:1768889-1768911 GGTGGAGGTGGAGGTGGTGGAGG + Intronic
1160971297 19:1768904-1768926 GGTGGAGGTGGAGGTGGTGGAGG + Intronic
1160971320 19:1768994-1769016 GGTGATGGTGGAGGTGGTGGAGG + Intronic
1160971369 19:1769189-1769211 GATGGAGGTGGAGGTGGTGAAGG + Intronic
1160971384 19:1769249-1769271 GGTGGAGGAGGAGGAGGTGCTGG + Intronic
1160971477 19:1769619-1769641 GGGTCAGGTGGCGGTGGTGATGG + Intronic
1161080700 19:2308541-2308563 TGTCCAGGTGCAGATGGTGGCGG - Intronic
1161178072 19:2859701-2859723 GGTGCTGGTGGTGGTGGTGGTGG - Exonic
1161265576 19:3362101-3362123 GCTCCAGGCAGAGCTGGTGCAGG + Intronic
1161385039 19:3986873-3986895 GGTACAGGTGTAGGTGGTTAGGG - Intergenic
1161425283 19:4199661-4199683 GCTGCAGGGGGAGGTGGTCCTGG - Exonic
1161469111 19:4447600-4447622 GGTGCAGGTGGATGTTGTCCAGG + Exonic
1161723952 19:5917923-5917945 GGGCCAGGATGCGGTGGTGCAGG + Exonic
1161993415 19:7698324-7698346 GGTCAAGGTGGAGGGGGTGGGGG - Intronic
1162133847 19:8543650-8543672 GGTGCTGGTGGTGGTGGTGGTGG + Intronic
1162133848 19:8543656-8543678 GGTGGTGGTGGTGGTGGTGCTGG + Intronic
1162133853 19:8543671-8543693 GGTGCTGGTGGTGGTGGTGGTGG + Intronic
1162133858 19:8543689-8543711 GGTGGTGGTGGTGGTGGTGCTGG + Intronic
1162133872 19:8543740-8543762 GGTGCTGGTGGTGGTGGTGGTGG + Intronic
1162133874 19:8543749-8543771 GGTGGTGGTGGTGGTGGTGCTGG + Intronic
1162133882 19:8543782-8543804 GGTGCTGGTGGTGGTGGTGCTGG + Intronic
1162133889 19:8543806-8543828 GGTGCTGGTGGTGGTGGTGGTGG + Intronic
1162133899 19:8543839-8543861 GGTGGTGGTGGTGGTGGTGCTGG + Intronic
1162133908 19:8543872-8543894 GGTGCTGGTGGTGGTGGTGGTGG + Intronic
1162133909 19:8543878-8543900 GGTGGTGGTGGTGGTGGTGCTGG + Intronic
1162133914 19:8543893-8543915 GGTGCTGGTGGTGGTGGTGGTGG + Intronic
1162133922 19:8543920-8543942 GGTGGTGGTGGTGGTGGTGCTGG + Intronic
1162133929 19:8543944-8543966 GGTGCTGGTGGTGGTGGTGGTGG + Intronic
1162133931 19:8543953-8543975 GGTGGTGGTGGTGGTGGTGCTGG + Intronic
1162133955 19:8544037-8544059 GGTGCTGGTGGTGGTGGTGGTGG + Intronic
1162183115 19:8884251-8884273 GTTCCTGGTGGTGATGGTGCAGG - Intronic
1162500502 19:11050805-11050827 GGTGCAGGTGGAGGGTGGGCAGG + Intronic
1162751431 19:12832423-12832445 GGTCCATCTTGAGGTGGTCCAGG + Intronic
1163035618 19:14567305-14567327 GGTGCAGGTGGAGGGGCTGAGGG - Intronic
1163368627 19:16889721-16889743 GGTCCTGGTGGTGGGGCTGCCGG + Exonic
1163487290 19:17595675-17595697 GCTCCTGGTGGAGGAGGTTCTGG - Intergenic
1163660325 19:18573177-18573199 GGACCAGTTGGACTTGGTGCAGG + Intronic
1163692124 19:18743731-18743753 GGTGCAGGTGGCGGTGGAGCTGG - Intronic
1164459230 19:28433326-28433348 GCTTCTGGGGGAGGTGGTGCTGG + Intergenic
1165062501 19:33211706-33211728 TGTCCAGGTGGGGGTGGGGCAGG - Intronic
1165065026 19:33223973-33223995 GGCCCTGGTGGTGGTGGTGGTGG - Intronic
1165253618 19:34559349-34559371 GGTCCCGGGGGAGGGGGTGCCGG + Intergenic
1165532723 19:36417835-36417857 GGTCCGCGAGGAGGTGGTGTGGG + Intronic
1165693674 19:37884099-37884121 TCACCAGGTGGAGGTGGTGCTGG + Intergenic
1165889283 19:39100887-39100909 GGTGGAGGGGGAGGTGGGGCTGG - Intronic
1166137092 19:40784092-40784114 GGACCAGGTGGTGGTGGGGGTGG + Intronic
1166373648 19:42315538-42315560 GGTCCTGGGGGAGGAGGGGCTGG + Intronic
1166697951 19:44864858-44864880 GGTCTAGGTGGAGAAGGTGAGGG - Intronic
1166810169 19:45509521-45509543 GGTGCTGGTGGTGGTGGTGGTGG - Intronic
1167019158 19:46861267-46861289 GGTCCAGGGGGAGGCGGGGACGG + Intergenic
1167167751 19:47810784-47810806 GGTGCAGGGGGAGGGGGTTCAGG + Intronic
1167424970 19:49425538-49425560 TGTTCAGGTGGAGGTGGAGGCGG - Intronic
1167898544 19:52601246-52601268 GGTCCAGGAGGAGGTGGGCGGGG - Intronic
1168241743 19:55092230-55092252 GCTCAAGGTGGAGCTGGAGCGGG - Exonic
1168332984 19:55580491-55580513 GGTCCCGGTGGAGGAGGGGCTGG + Intronic
1168347143 19:55655402-55655424 GGTCCTGGCGGAGGTGGCGCGGG + Intronic
925003483 2:424660-424682 GGTGGTGGTGGAGGTGGTGGAGG - Intergenic
925165029 2:1710707-1710729 GGTGCTGGTGGAGTGGGTGCTGG - Intronic
925165033 2:1710722-1710744 GGTGCTGGTGGAGAGGGTGCTGG - Intronic
925165037 2:1710737-1710759 GGTGCTGGTGGAGTGGGTGCTGG - Intronic
925165041 2:1710752-1710774 GGTGCTGGTGGAGTGGGTGCTGG - Intronic
925165049 2:1710784-1710806 GGTGCTGGTGGAGTGGGTGCTGG - Intronic
925165053 2:1710799-1710821 GGTGCTGGTGGAGTGGGTGCTGG - Intronic
925165061 2:1710831-1710853 GGTGCTGGTGGAGTGGGTGCTGG - Intronic
925165065 2:1710846-1710868 GGTGCTGGTGGAGTGGGTGCTGG - Intronic
925165073 2:1710878-1710900 GGTGCTGGTGGAGCAGGTGCTGG - Intronic
925165080 2:1710910-1710932 GGTGCTGGTGGAGTGGGTGCTGG - Intronic
925165094 2:1710972-1710994 GGTGCTGGTGGAGCGGGTGCTGG - Intronic
925165098 2:1710987-1711009 GGTGCTGGTGGAGTGGGTGCTGG - Intronic
925165134 2:1711147-1711169 GGTGCTGGTGGAGCGGGTGCTGG - Intronic
925165142 2:1711179-1711201 GGTGCTGGTGGAGCGGGTGCTGG - Intronic
925165146 2:1711194-1711216 GGTGCTGGTGGAGCGGGTGCTGG - Intronic
925165160 2:1711256-1711278 GGTGCTGGTGGAGCGGGTGCTGG - Intronic
925165172 2:1711305-1711327 GGTGCTGGTGGAGCGGGTGCTGG - Intronic
925165176 2:1711320-1711342 GGTGCTGGTGGAGCGGGTGCTGG - Intronic
925165208 2:1711463-1711485 GGTGCTGGTGGAGCGGGTGCTGG - Intronic
925165212 2:1711478-1711500 GGTGCTGGTGGAGCGGGTGCTGG - Intronic
925165234 2:1711574-1711596 GGTGCTGGTGGAGTGGGTGCTGG - Intronic
925165246 2:1711623-1711645 GGTGCTGGTGGAGCGGGTGCTGG - Intronic
925165250 2:1711638-1711660 GGTGCTGGTGGAGTGGGTGCTGG - Intronic
925194241 2:1910430-1910452 GATGCAGGTGGAGCTGGTGAGGG + Intronic
925331997 2:3065572-3065594 GGTACAGGTGCAGGGTGTGCAGG - Intergenic
925635393 2:5937292-5937314 GGTCCTGGGTTAGGTGGTGCAGG + Intergenic
926715634 2:15921667-15921689 GAAGCAGGTGGAGGGGGTGCAGG - Intergenic
926907079 2:17816066-17816088 GGTCCTGGTGGAGGGGATGGAGG + Intergenic
927460629 2:23295445-23295467 GTTCCAGGTGGAGGGGTTGGAGG + Intergenic
927502028 2:23589391-23589413 TGTCCAGGTGGAGGCGGCCCTGG + Intronic
927760006 2:25744217-25744239 GGTCCAGGAGAGGGTGGTGAAGG - Exonic
928490542 2:31778453-31778475 GGTGCTGGTGGAGGTGGGGCTGG - Intergenic
929039499 2:37729881-37729903 GGTGCTGGTGGTGGTGGTGGTGG - Intronic
929604368 2:43225389-43225411 GCTGCAGGTGCAGGAGGTGCTGG + Exonic
929650977 2:43678743-43678765 GGTGGAGGTGGAGGTGGAGGTGG + Intronic
929650979 2:43678749-43678771 GGTGGAGGTGGAGGTGGAGGTGG + Intronic
930022172 2:47008077-47008099 GGGCCGGGAGGAGGTGGGGCTGG + Intronic
930025078 2:47024845-47024867 AGTCATGGTGGAGGTGGTCCTGG - Intronic
930308231 2:49703771-49703793 GGTACATGTGCAGGTTGTGCAGG - Intergenic
930414331 2:51070866-51070888 GGTACATGTGCAGGTTGTGCAGG + Intergenic
930534559 2:52630146-52630168 GGCCCAGCTGGGGGTGGGGCGGG - Intergenic
931193180 2:60025042-60025064 TGTCCTGGTGGTGGTGGTGGTGG - Intergenic
931547926 2:63409151-63409173 TGTCCTGGTGGAGGTGGTGGGGG - Intronic
932062861 2:68526473-68526495 GGTTCTGGTGGAGATGGTACAGG + Intronic
932355440 2:71064639-71064661 GGTGGAGGTGGAGGTGGAGGTGG - Intronic
932485871 2:72083993-72084015 GGTGATGGTAGAGGTGGTGCAGG + Intergenic
932592541 2:73075910-73075932 GGTCCTGGTGAGGGTGGGGCAGG - Intronic
932599245 2:73112696-73112718 CGTCCAGGTGACGGTGCTGCGGG - Exonic
932714258 2:74090106-74090128 GGTCCAGCGGGAGGTAGTACTGG + Intronic
932842266 2:75094661-75094683 GATAGAGGTGGAGGTGGTGGAGG + Intronic
933228223 2:79775490-79775512 GGTACATGTGCAGGAGGTGCAGG + Intronic
933849750 2:86356373-86356395 GGGCCAGGGGGAGCAGGTGCAGG + Intergenic
934660070 2:96138588-96138610 GCTGCAGGTGGAGGTGGTTGGGG - Intergenic
934660089 2:96138642-96138664 GCTGCAGGTGGAGGTGGTTGGGG - Intergenic
935360927 2:102245678-102245700 GGTGGCGGTGGCGGTGGTGCGGG + Intergenic
935588589 2:104824371-104824393 GGTGCTGGTGGTGGTGGTGGTGG + Intergenic
935592855 2:104856842-104856864 GCTCGAGAAGGAGGTGGTGCGGG + Exonic
935797739 2:106661827-106661849 GGTACATGTGCAGGAGGTGCAGG - Intergenic
936009790 2:108918238-108918260 GGTGCAGGTGCAGGGGGTGCCGG - Intronic
936294029 2:111251538-111251560 GGTGATGGTGGAGGTGGTGATGG - Intergenic
936873858 2:117164852-117164874 GGTCCAGAAAGAGGTGGTCCAGG + Intergenic
936997816 2:118433810-118433832 GGTGCAGGGGGTGGTGGGGCGGG + Intergenic
937220300 2:120339297-120339319 GGTGCAGCTGGAGGGGGTGTGGG + Intergenic
937321331 2:120962529-120962551 GGTCCAGAGGCAGGTGGTGTTGG + Intronic
938161491 2:128988437-128988459 GGACCAGGTGGAGGTGGTGGTGG + Intergenic
938675560 2:133630106-133630128 GGTCCATGTGCAGGATGTGCAGG - Intergenic
939993425 2:148897970-148897992 GCTCCAGGGAGAGGTGGTGCTGG + Intronic
941008917 2:160276405-160276427 GGTGGAGGTGGTGGTGGTGGTGG - Intronic
941268202 2:163390615-163390637 GAACCAGGTGGAGGTACTGCAGG - Intergenic
942695971 2:178645961-178645983 GGAGCAGGTGGAGGAGGTGGGGG + Exonic
943501294 2:188693021-188693043 GGTGCTGGTGGGGGTGGGGCTGG + Intergenic
944199911 2:197095519-197095541 GGTCCTGGTGGCTGAGGTGCAGG - Intronic
944242481 2:197499747-197499769 GAGCCGGGGGGAGGTGGTGCGGG + Intronic
944309909 2:198222044-198222066 GGACCAGCTGGAACTGGTGCTGG - Intronic
945126752 2:206520252-206520274 GGCTCAGGTTGTGGTGGTGCAGG + Intronic
945600986 2:211864387-211864409 GCTCCAGGTGGAGGAGTTCCTGG - Intronic
946125559 2:217559526-217559548 GGTCCATGTGCAGGATGTGCAGG - Intronic
946395554 2:219442165-219442187 GGGCCCGGTGGAGGGGGCGCTGG + Intronic
946834951 2:223763501-223763523 GGGGCAGGTGGAGGGGGTGGAGG - Intronic
946919228 2:224560680-224560702 AGACCAGTTGGAGGTGGTGGTGG - Intronic
947727646 2:232409938-232409960 GCTCCAGGTGGAGGTCCGGCAGG - Exonic
947831459 2:233144526-233144548 GGTGAGGGTGGAGGTGGTGGTGG + Intronic
947831460 2:233144532-233144554 GGTGGAGGTGGTGGTGGTGATGG + Intronic
948154853 2:235773002-235773024 GTTCCTGGTGGAGGGGGTCCAGG + Intronic
948258069 2:236583067-236583089 GGCAGAGGTGGAGGTGGTGAGGG - Intergenic
948537405 2:238656442-238656464 GGTCTAGTTGGGGGTGGGGCAGG - Intergenic
948541799 2:238696528-238696550 GGTAGAGGTGGAGGAGCTGCAGG + Intergenic
948793910 2:240392518-240392540 TGCCCAGGTCGTGGTGGTGCAGG + Intergenic
948859441 2:240745817-240745839 TGCCCAGGCGGAGGTGGTCCAGG + Exonic
948891579 2:240909375-240909397 GCTCCAGGTGGAGGAGGTAGAGG - Intergenic
948931409 2:241134813-241134835 GGTCCAGGTGATGGTGTGGCAGG - Intronic
948953742 2:241272186-241272208 GCGGCAGGTGGAGGTGCTGCGGG + Intronic
948976507 2:241466696-241466718 GGTACGGGTGGTGGTGGTGGGGG - Intronic
949000248 2:241609150-241609172 GGGCCAGGTGGCCGTGGTGGAGG + Intronic
1168771893 20:420900-420922 GGTCCAGCTGGACGTGCTGCAGG - Exonic
1168799798 20:637038-637060 GGTGGTGGTGGTGGTGGTGCTGG - Intergenic
1168811997 20:710364-710386 GGGCCGGGGGGAGGGGGTGCTGG - Intergenic
1168972106 20:1937969-1937991 GGTGGTGGTGGAGGTGGTGGAGG - Exonic
1169142355 20:3233699-3233721 GGTCAAGGTCGAGGGGGTTCTGG - Intronic
1169654105 20:7903527-7903549 GGTGGTGGTGGAGGTGGTGGTGG + Intronic
1169713535 20:8590842-8590864 GGTCCATGTGCAGGACGTGCAGG + Intronic
1170852515 20:20017615-20017637 GGTCCAGGGAGAGGTGGGCCTGG + Intronic
1171137831 20:22712824-22712846 GGTACATGTGGAGGATGTGCAGG + Intergenic
1171165645 20:22967798-22967820 TGTTCTGGTGGAGGTGGTGGAGG - Intergenic
1171298814 20:24041760-24041782 GATCCATGTGGAGGTGGTGGAGG - Intergenic
1171447614 20:25215967-25215989 GGTCCTGGTGGATGTTCTGCAGG - Intronic
1171489798 20:25508804-25508826 GGTGCAGGTGTAGGGAGTGCAGG - Intronic
1171988677 20:31678758-31678780 GGACTAGTTGGAGGCGGTGCTGG - Intronic
1172091271 20:32434648-32434670 GGCCCGGGTGGAGGTGGCGGCGG + Exonic
1172117416 20:32581265-32581287 GGCCCAAGTGGGGGTGGGGCAGG - Intronic
1172871457 20:38138122-38138144 GCTCCAGGTTGAGGTTGAGCAGG + Exonic
1172957565 20:38771781-38771803 GCTGCTGGTGGAGGTGGTGCTGG + Exonic
1173565058 20:44032558-44032580 GTGCCAGGTGGTGGTGGTGGTGG + Intronic
1173883791 20:46439241-46439263 GGTACAGGTGCAGGATGTGCAGG - Intergenic
1174080945 20:47970438-47970460 GGTCAAAGTGGAGGAGGTGAGGG - Intergenic
1174956707 20:55105989-55106011 GGTACAGGTGGTAGTGGTGGTGG + Intergenic
1175222318 20:57424432-57424454 AGTCCAGGTGGAGCTGTTCCCGG - Intergenic
1175420928 20:58833020-58833042 GCACCTGGTGGAGATGGTGCAGG - Intergenic
1175501298 20:59452957-59452979 GGTGCAGCTGGAGGAGGTGCAGG + Intergenic
1175895575 20:62334293-62334315 GCTCCAGGCGCAGGTGGTGCAGG + Exonic
1176170242 20:63693451-63693473 GGTGGAGGTGGAGGTGGAGGTGG - Intronic
1176170244 20:63693457-63693479 GGTGGAGGTGGAGGTGGAGGTGG - Intronic
1176170246 20:63693463-63693485 GGTGGAGGTGGAGGTGGAGGTGG - Intronic
1176170252 20:63693481-63693503 GGTGGAGGTGGAGGTGGTGGTGG - Intronic
1176170262 20:63693511-63693533 GGTGGAGGTGGTGGTGGTGGAGG - Intronic
1176170264 20:63693517-63693539 GGTGGTGGTGGAGGTGGTGGTGG - Intronic
1176170271 20:63693538-63693560 GGTGGAGGTGGTGGTGGTGGTGG - Intronic
1176170273 20:63693544-63693566 GGTGGAGGTGGAGGTGGTGGTGG - Intronic
1176170278 20:63693559-63693581 GGTGGAGGTGGAGGTGGTGGAGG - Intronic
1176170283 20:63693574-63693596 GGTGGAGGTGGTGGTGGTGGAGG - Intronic
1176170285 20:63693580-63693602 GGTGGAGGTGGAGGTGGTGGTGG - Intronic
1176170290 20:63693595-63693617 GGTGGAGGTGGTGGTGGTGGAGG - Intronic
1176170292 20:63693601-63693623 GGTGGAGGTGGAGGTGGTGGTGG - Intronic
1176170298 20:63693619-63693641 GGTGGTGGTGGAGGTGGTGGTGG - Intronic
1176170301 20:63693628-63693650 GGTGGAGGTGGTGGTGGTGGAGG - Intronic
1176170303 20:63693634-63693656 GGTGGAGGTGGAGGTGGTGGTGG - Intronic
1176170309 20:63693652-63693674 GGTGGTGGTGGAGGTGGTGGTGG - Intronic
1176170321 20:63693688-63693710 GGTGGAGGTGGTGGTGGTGGTGG - Intronic
1176170323 20:63693694-63693716 GGTGGTGGTGGAGGTGGTGGTGG - Intronic
1176170326 20:63693703-63693725 GGTGCAGGTGGTGGTGGTGGAGG - Intronic
1176170337 20:63693739-63693761 GGTGGAGGTGGTGGTGGTGGTGG - Intronic
1176170339 20:63693745-63693767 GGTGGAGGTGGAGGTGGTGGTGG - Intronic
1176180488 20:63747367-63747389 GGGCCTGGTGGAGGTGGGGGGGG + Intronic
1176180518 20:63747443-63747465 GGGCCTGGTGGAGGTGGGGGGGG + Intronic
1176191868 20:63815239-63815261 GGTGCAGGTGCAGTGGGTGCAGG + Intronic
1176191959 20:63815719-63815741 GGTGCAGGTGCAGTAGGTGCAGG + Intronic
1176192044 20:63816140-63816162 GGTGCAGGTGCAGTGGGTGCAGG + Intronic
1176927100 21:14763865-14763887 GGTCCAGTTGGAGGTGGTGGTGG + Intergenic
1176998946 21:15588328-15588350 GTTCCAGGTGGAGATGGGGAAGG - Intergenic
1177043833 21:16145714-16145736 GGTCCTGCTGGAGGTGGTATTGG + Intergenic
1177390758 21:20468121-20468143 GGACGAAGTGGAGGTGGTGTAGG - Intergenic
1178162992 21:29939936-29939958 GGTACAGGGTGAGTTGGTGCAGG + Intronic
1179134523 21:38667923-38667945 GGTGCAGGGGGACTTGGTGCAGG - Intergenic
1179373340 21:40827158-40827180 GGTCCAGGTGAAGGTGTTTCAGG + Intronic
1179487017 21:41716948-41716970 GGTTCAGGTGTAGGTGGGGGCGG - Intergenic
1179493484 21:41756569-41756591 GGTCCAGGTGCAGGAGTGGCGGG + Exonic
1179589293 21:42395444-42395466 GGTAGAGGTGGAGGCGGAGCCGG - Exonic
1179801543 21:43813579-43813601 TGGCCAGGAGCAGGTGGTGCCGG + Intergenic
1179862431 21:44197337-44197359 GGGCCTGGTGGAGGAGGTCCTGG + Intergenic
1180075483 21:45459494-45459516 GGACGAGGTGGAGGGGGCGCTGG - Intronic
1180158172 21:45987886-45987908 GGTCCAGATGGAGGGGATGGCGG + Intronic
1180158377 21:45988446-45988468 GGTCCAGATGGAGGGGATGTCGG + Intronic
1180228966 21:46414822-46414844 TGTCCAGGAGGAGGAGGAGCAGG - Intronic
1180609557 22:17086225-17086247 GGTGGAGGTGGAGGTGGAGGTGG - Intronic
1180615404 22:17122758-17122780 GGGGGAGGTGGAGATGGTGCAGG - Intronic
1180647042 22:17347835-17347857 GGTCCCAGTGGACGTGGTGCGGG - Intergenic
1180707240 22:17817357-17817379 GGCCCCGCTGGAGGGGGTGCTGG + Exonic
1180782711 22:18529794-18529816 GGTGCAGGTGAAGGTGATGGAGG + Intronic
1180920185 22:19517612-19517634 GGCCCAGGTCAAGGTGGGGCAGG + Intronic
1180954878 22:19737112-19737134 GGTGCAGGTGAGGGTGGGGCCGG - Intergenic
1181126271 22:20703821-20703843 GGTGCAGGTGAAGGTGATGGAGG + Intergenic
1181167122 22:20989741-20989763 GGCGCAGGTGGAGGAGGTGAGGG + Intronic
1181239601 22:21469132-21469154 GGTGCAGGTGAAGGTGATGGAGG + Intergenic
1181456713 22:23064062-23064084 GCTGCAGGTGGAGGTGGAGGAGG - Exonic
1181601269 22:23953213-23953235 GACCAAGGTGGTGGTGGTGCAGG + Intergenic
1181607242 22:23988124-23988146 GACCAAGGTGGTGGTGGTGCAGG - Intergenic
1181672219 22:24430980-24431002 GGTACAAGTGGAGCTGGTGCTGG - Intronic
1182351348 22:29701788-29701810 GGTGCAGGTGGAGGGGATGGAGG - Intergenic
1183149265 22:36025268-36025290 GGTTCAGGTAGAGGAGGTGAGGG - Intronic
1183355280 22:37355475-37355497 TGGCGAGGTGGAGGTGGTGCTGG + Intergenic
1183468016 22:37989850-37989872 GCTCCAGGGGAAGGTGGAGCAGG - Intronic
1183820878 22:40345156-40345178 AGTGCAGGTGGAGAGGGTGCAGG + Intergenic
1183906107 22:41041565-41041587 GGGCCAGGTGGTGGGGGTGGGGG - Intergenic
1184097387 22:42323898-42323920 GGTGGAGGTGGTGGTGGTGATGG + Intronic
1184244788 22:43230447-43230469 GATACAGGTGGGGGTGGGGCGGG + Intronic
1184289715 22:43492041-43492063 GGTGGTGATGGAGGTGGTGCTGG + Intronic
1184290278 22:43495223-43495245 GGTGGTGGTGGAGGTGGTGGTGG + Intronic
1184290279 22:43495229-43495251 GGTGGAGGTGGTGGTGGTGATGG + Intronic
1184290335 22:43495466-43495488 GGTGATGGTGGAGGTGGTGGTGG + Intronic
1184290345 22:43495499-43495521 GGTGGAGGTGGTGGTGGTGGTGG + Intronic
1184290349 22:43495511-43495533 GGTGGTGGTGGAGGTGGTGGTGG + Intronic
1184290365 22:43495568-43495590 GGTGATGGTGGAGGTGGTGGTGG + Intronic
1184290367 22:43495574-43495596 GGTGGAGGTGGTGGTGGTGGAGG + Intronic
1184290369 22:43495583-43495605 GGTGGTGGTGGAGGTGGTGATGG + Intronic
1184290396 22:43495685-43495707 GGTGGTGGTGGAGGTGGTGATGG + Intronic
1184290405 22:43495712-43495734 GGTGGTGGTGGAGGTGGTGGTGG + Intronic
1184290407 22:43495718-43495740 GGTGGAGGTGGTGGTGGTGGAGG + Intronic
1184290423 22:43495778-43495800 GGTGGTGGTGGAGGTGGTGATGG + Intronic
1184290432 22:43495805-43495827 GGTGGTGGTGGAGGTGGTGGTGG + Intronic
1184290434 22:43495811-43495833 GGTGGAGGTGGTGGTGGTGGAGG + Intronic
1184290487 22:43496006-43496028 GGTGGTGGTGGAGGTGGTGATGG + Intronic
1184290492 22:43496021-43496043 GGTGATGGTGGAGGTGGTGGTGG + Intronic
1184290494 22:43496027-43496049 GGTGGAGGTGGTGGTGGTGGAGG + Intronic
1184290496 22:43496036-43496058 GGTGGTGGTGGAGGTGGTGATGG + Intronic
1184290501 22:43496051-43496073 GGTGATGGTGGAGGTGGTGGTGG + Intronic
1184290517 22:43496108-43496130 GGTGGTGGTGGAGGTGGTGGTGG + Intronic
1184290519 22:43496114-43496136 GGTGGAGGTGGTGGTGGTGGAGG + Intronic
1184290521 22:43496123-43496145 GGTGGTGGTGGAGGTGGTGATGG + Intronic
1184290526 22:43496138-43496160 GGTGATGGTGGAGGTGGTGGTGG + Intronic
1184290528 22:43496144-43496166 GGTGGAGGTGGTGGTGGTGGAGG + Intronic
1184290530 22:43496153-43496175 GGTGGTGGTGGAGGTGGTGATGG + Intronic
1184290535 22:43496168-43496190 GGTGATGGTGGAGGTGGTGGTGG + Intronic
1184290551 22:43496225-43496247 GGTGGTGGTGGAGGTGGTGGTGG + Intronic
1184290555 22:43496237-43496259 GGTGGTGGTGGAGGTGGTGGTGG + Intronic
1184290567 22:43496279-43496301 GGTGGTGGTGGAGGTGGTGGTGG + Intronic
1184290586 22:43496348-43496370 GGTGGTGGTGGAGGTGGTGGTGG + Intronic
1184290588 22:43496354-43496376 GGTGGAGGTGGTGGTGGTGGAGG + Intronic
1184290598 22:43496393-43496415 GGTGGTGGTGGAGGTGGTGATGG + Intronic
1184290607 22:43496420-43496442 GGTGGTGGTGGAGGTGGTGGTGG + Intronic
1184290609 22:43496426-43496448 GGTGGAGGTGGTGGTGGTGGAGG + Intronic
1184290665 22:43496636-43496658 GGTGGTGGTGGAGGTGGTGGTGG + Intronic
1184290667 22:43496642-43496664 GGTGGAGGTGGTGGTGGTGGAGG + Intronic
1184290702 22:43496765-43496787 GGTGGTGGTGGAGGTGGTGGTGG + Intronic
1184290706 22:43496777-43496799 GGTGGTGGTGGAGGTGGTGGTGG + Intronic
1184290716 22:43496807-43496829 GGTGGTGGTGGAGGTGGTGGTGG + Intronic
1184290718 22:43496813-43496835 GGTGGAGGTGGTGGTGGTGGAGG + Intronic
1184290721 22:43496822-43496844 GGTGGTGGTGGAGGTGGTGGTGG + Intronic
1184290737 22:43496879-43496901 GGTGGTGGTGGAGGTGGTGGTGG + Intronic
1184290739 22:43496885-43496907 GGTGGAGGTGGTGGTGGTGGAGG + Intronic
1184290742 22:43496894-43496916 GGTGGTGGTGGAGGTGGTGGTGG + Intronic
1184290744 22:43496900-43496922 GGTGGAGGTGGTGGTGGTGGAGG + Intronic
1184290747 22:43496909-43496931 GGTGGTGGTGGAGGTGGTGGTGG + Intronic
1184290749 22:43496915-43496937 GGTGGAGGTGGTGGTGGTGGAGG + Intronic
1184290758 22:43496945-43496967 GGTGGAGGTGGTGGTGGTGGAGG + Intronic
1184290771 22:43496990-43497012 GGTGGAGGTGGTGGTGGTGGAGG + Intronic
1184290790 22:43497059-43497081 GGTGGTGGTGGAGGTGGTGGTGG + Intronic
1184291230 22:43499075-43499097 GGTGATGGTGGAGGTGGTGGTGG + Intronic
1184291232 22:43499081-43499103 GGTGGAGGTGGTGGTGGTGGAGG + Intronic
1184291234 22:43499090-43499112 GGTGGTGGTGGAGGTGGTGATGG + Intronic
1184291353 22:43499547-43499569 GGTGGTGGTGGAGGTGGTGGTGG + Intronic
1184291417 22:43499769-43499791 GGTGATGGTGGAGGTGGTGGTGG + Intronic
1184291440 22:43499847-43499869 GGTGATGGTGGAGGTGGTGGTGG + Intronic
1184291463 22:43499925-43499947 GGTGATGGTGGAGGTGGTGGTGG + Intronic
1184291465 22:43499931-43499953 GGTGGAGGTGGTGGTGGTGGTGG + Intronic
1184291487 22:43500006-43500028 GGTGATGGTGGAGGTGGTGGTGG + Intronic
1184291548 22:43500216-43500238 GGTGATGGTGGAGGTGGTGATGG + Intronic
1184291577 22:43500324-43500346 GGTGGTGGTGGAGGTGGTGGTGG + Intronic
1184291578 22:43500330-43500352 GGTGGAGGTGGTGGTGGTGATGG + Intronic
1184291605 22:43500429-43500451 GGTGGTGGTGGAGGTGGTGACGG + Intronic
1184378944 22:44132988-44133010 GGTGCAGGTGGTGGTCGTGCGGG + Exonic
1184472267 22:44702584-44702606 GTTCCAGGTGGCGTTGGCGCAGG - Exonic
1184625280 22:45722693-45722715 GGTCCAAGCGGATGAGGTGCAGG - Intronic
1184651888 22:45923179-45923201 CGTGCAGGTGGAGGTGGTGCGGG - Exonic
1184715928 22:46281829-46281851 GGTGCAGGTGGAGGAGGAGAGGG - Intronic
1184777586 22:46631240-46631262 GGTGGAGGTGGAGGTGGCGATGG - Intronic
1184777587 22:46631246-46631268 GGTGGAGGTGGAGGTGGAGGTGG - Intronic
1184804923 22:46788557-46788579 GGTCCCAGTGGGGCTGGTGCTGG - Intronic
1184921310 22:47607719-47607741 AGCCCGGGTGGAGGTGATGCTGG + Intergenic
1185043445 22:48517411-48517433 GTCCCAGGAGGAGGTGGTGGGGG - Intronic
1185072113 22:48662124-48662146 GCTCCAGGTGGACGTGGGGCTGG + Intronic
1185247443 22:49780653-49780675 GGTCCAGGTGGAGGCTGGGAGGG - Intronic
1185329509 22:50245880-50245902 GGGCAGGGTGGAGGTGCTGCGGG - Intronic
1185391886 22:50566454-50566476 GCTCCTGGTGGTGGTGGAGCTGG - Intergenic
950205463 3:11076849-11076871 GGGCGAGGTGGAGGAGGAGCAGG - Intergenic
950590209 3:13931649-13931671 GGTCGAGGTGGTGGTGGTGGAGG - Intergenic
950710288 3:14809230-14809252 GGTCGAGGTGGTGGTGGTAGAGG - Intergenic
950831486 3:15879582-15879604 GGTGGAGGTCGAGGTGGTGGAGG + Intergenic
951166478 3:19489181-19489203 GGTGGAGGTGGAGGTGCTGTGGG + Intronic
951269666 3:20608607-20608629 TGTTCTGGTGGAGGTGGTGGGGG - Intergenic
951334615 3:21406063-21406085 GGCCCAGGTACTGGTGGTGCCGG - Intergenic
951823144 3:26836544-26836566 GGTGCTGGTGGTGGAGGTGCTGG + Intergenic
951937611 3:28038905-28038927 GGTCGGGGTGGGGGTGGTGGGGG + Intergenic
952358162 3:32603708-32603730 GCTCCTGGTGGAGGTGGTCTGGG + Intergenic
952478059 3:33731575-33731597 GGTGCAGGTGTAGATGGTGCAGG - Intergenic
952841679 3:37651959-37651981 GGTAGAGGTGGAGGTGGAGATGG - Intronic
953173087 3:40525118-40525140 GGTCCGGGTGAAGGAGGGGCGGG - Exonic
953723906 3:45381278-45381300 TGTTCTGGTGGAGGTGGTGGGGG + Intergenic
954292781 3:49658470-49658492 GGACCAGGTGTGGGTGGTGAAGG - Intronic
954424711 3:50437327-50437349 GGGCAAGGTGGAGGGGATGCAGG - Intronic
954660127 3:52222566-52222588 GGGCCAGGCTGAGGTGGCGCAGG + Exonic
954719665 3:52550570-52550592 GGTCCAGCTGGATGTGGGCCGGG + Exonic
954749428 3:52805287-52805309 AGTCCAAATGGAGGTGGGGCAGG - Intronic
954861593 3:53695168-53695190 GGTCCCCGTGGAGGAGGTGCTGG + Intronic
955175580 3:56610955-56610977 TGTTCTGGTGGAGGTGGTGGAGG + Intronic
955198722 3:56830240-56830262 AGTGATGGTGGAGGTGGTGCTGG + Intronic
955224232 3:57048126-57048148 GGGCGGGGTGGTGGTGGTGCTGG - Intronic
955379391 3:58424766-58424788 GGTGGAGGTGGAGGAGGTGGAGG - Exonic
955916518 3:63912792-63912814 GGCCGAGGTGGAGGCGGCGCCGG - Exonic
956422983 3:69103852-69103874 GGCTCAGGTGGAGGAGGTCCAGG + Intronic
956603499 3:71048811-71048833 GGTACAGCTGGAGGTGGGGGAGG + Intronic
958085974 3:88807594-88807616 GGCAGAGGTGGAGGTGGGGCAGG - Intergenic
958756155 3:98251510-98251532 GGTACATGTGAAGGTTGTGCAGG - Intergenic
961372842 3:126441764-126441786 CGTCCAGGTCCAGCTGGTGCAGG - Exonic
961384626 3:126516609-126516631 GGGGCAGGTGGAGCGGGTGCTGG - Intronic
961427753 3:126861527-126861549 GGTGCTGGTGGTGGTGGTGTTGG - Intronic
961427876 3:126861929-126861951 GGTGAAGAGGGAGGTGGTGCTGG - Intronic
961427890 3:126861977-126861999 GGTGGAGGGGGAGGTGGTGATGG - Intronic
961427956 3:126862166-126862188 GGTGGAGGAGGAGGTGGTGATGG - Intronic
961428018 3:126862397-126862419 GGTGGAGGAGGAGGTGGTGATGG - Intronic
961428031 3:126862442-126862464 GGTGGAGGAGGAGGTGGTGATGG - Intronic
961428066 3:126862562-126862584 GGTGGAGGAGGAGGTGGTGATGG - Intronic
961428115 3:126862721-126862743 GGTGGAGGAGGAGGTGGTGATGG - Intronic
961428121 3:126862742-126862764 GGTGGAGGAGGAGGTGGTGATGG - Intronic
961428149 3:126862835-126862857 GGTGGAGGAGGAGGTGGTGATGG - Intronic
961428155 3:126862856-126862878 GGTGGAGGAGGAGGTGGTGATGG - Intronic
961428189 3:126862973-126862995 GGTGGAGGAGGAGGTGGTGATGG - Intronic
961428195 3:126862994-126863016 GGTGGAGGAGGAGGTGGTGATGG - Intronic
961428237 3:126863147-126863169 GGTGGAGGAGGAGGTGGTGATGG - Intronic
961428268 3:126863240-126863262 GGTGGAGGAGGAGGTGGTGATGG - Intronic
961428350 3:126863546-126863568 GGTGGAGGAGGAGGTGGTGATGG - Intronic
961428425 3:126863828-126863850 GGTGGAGGAGGAGGTGGTGATGG - Intronic
961428437 3:126863873-126863895 GGTGGAGGAGGAGGTGGTGATGG - Intronic
961428454 3:126863942-126863964 GGTGGAGGAGGAGGTGGTGATGG - Intronic
961513553 3:127419279-127419301 GGCCCAGGTGGGGGTGGGGAGGG + Intergenic
961521221 3:127468381-127468403 GGTGCAGGTTGAGATGGAGCAGG + Intergenic
961534781 3:127563735-127563757 GGTGCTGGTGGTGGTGGTGCTGG - Intergenic
961656570 3:128445705-128445727 GGTGATGGTGGTGGTGGTGCTGG + Intergenic
961656623 3:128445941-128445963 GGTGCTGGTGGTGGTGGTGATGG + Intergenic
961973138 3:130991322-130991344 GGTGGTGGTGGTGGTGGTGCAGG + Intronic
962382777 3:134910847-134910869 GGTCAAGGGGAGGGTGGTGCTGG - Intronic
962706725 3:138051162-138051184 GGTGGAGGTGGAGGTGGTAGTGG + Intergenic
962706743 3:138051245-138051267 GGTGGAGGTGGAGGTGGTAGTGG + Intergenic
964783994 3:160373509-160373531 GGACCAGGTAGGGGTGGTTCAGG + Intronic
966680066 3:182632399-182632421 GGTGCTGGTGGTGGTGGTGGTGG + Intergenic
966748343 3:183299289-183299311 GATTCTGGTGCAGGTGGTGCAGG - Intronic
967197462 3:187041033-187041055 GGGCCATGTGGAGGTGATACGGG - Intronic
967773465 3:193359819-193359841 GGTGGTGGTGGTGGTGGTGCAGG + Intronic
967859017 3:194137886-194137908 GGTCCCGGTGGGGGCGGTGGCGG - Exonic
968066516 3:195762329-195762351 GGGCGGGGTGGGGGTGGTGCGGG - Intronic
968128791 3:196179980-196180002 CCTCCAGGTGGAGTTGGAGCTGG - Intergenic
968494350 4:907221-907243 GGTGCAGGTGGGGGCAGTGCTGG - Intronic
968555470 4:1244544-1244566 TGTCCTGGTGGAGGTCGTGAGGG - Intronic
968563280 4:1296079-1296101 GGCGCACGTGAAGGTGGTGCAGG - Intronic
968563337 4:1296280-1296302 GGCGCACGTGAAGGTGGTGCAGG - Intronic
968595128 4:1478238-1478260 GGTGGGGGTGGAGGTGGGGCAGG - Intergenic
968698199 4:2042699-2042721 GGTCAGGGTGGAGGGGGCGCAGG - Intronic
968838467 4:2982258-2982280 GGGCCTGGATGAGGTGGTGCTGG - Intronic
968902195 4:3437005-3437027 GGCCCCTCTGGAGGTGGTGCAGG + Intronic
968950278 4:3687886-3687908 AGTCCATCTGGAGGTGGGGCTGG + Intergenic
969450221 4:7268746-7268768 CTTCCAGGAGGAGGTGATGCTGG + Intronic
969465513 4:7354004-7354026 GGTGCGGGTAAAGGTGGTGCAGG - Intronic
969529765 4:7724144-7724166 GGTCGTGGTGGTGGTGGTGATGG + Intronic
969692820 4:8713955-8713977 GGTACATGTGCAGGTTGTGCAGG - Intergenic
969894506 4:10290847-10290869 GGTGGGGGTGGGGGTGGTGCAGG + Intergenic
970047043 4:11866197-11866219 GGTACAGGTGCAGGATGTGCAGG - Intergenic
970191505 4:13523206-13523228 GGTCCTGGTGCATGTGGTTCGGG - Intergenic
971010592 4:22430377-22430399 GGTCCAGGCTGAGGTGGTCTGGG + Intronic
971245260 4:24921541-24921563 AGCCCTGGTGCAGGTGGTGCTGG + Intronic
971482261 4:27125329-27125351 GGTCCAGGTGGGGGAGATGATGG - Intergenic
973285417 4:48410664-48410686 GGTCCTGGTGCTGGTGCTGCAGG - Intronic
974049879 4:56930811-56930833 TGTTCAGATGGAGGTGGTTCAGG + Exonic
974190160 4:58494030-58494052 ACTCCAGGTGAAGGGGGTGCTGG + Intergenic
975863095 4:78698785-78698807 GGTGCTGGTGGTGGTGGTGGTGG + Intergenic
975971227 4:80040241-80040263 GGTACATGTGCAGGTTGTGCAGG - Intronic
976731443 4:88266364-88266386 CTTCCAAGTGGAGGTGATGCTGG + Intronic
977069435 4:92365481-92365503 GGTGCTGGTGGTGGTGGTGGTGG + Intronic
977498207 4:97803451-97803473 GGTGGAGGTGGAGGTGGGGGAGG + Intronic
977666923 4:99653317-99653339 CGTCCGGGTGGTGTTGGTGCTGG + Exonic
977733266 4:100380241-100380263 TGTTCAGGTGGAGGTGGTTAAGG - Intergenic
978369741 4:108018244-108018266 GTTCCAGGTGCTTGTGGTGCAGG + Intronic
978723872 4:111947237-111947259 GGTACATGTGCAGATGGTGCAGG + Intergenic
979473252 4:121125607-121125629 GGGCCAGGTGAAGGTGGTGCAGG + Intergenic
981546778 4:145902234-145902256 GGTGGTGGTGGAGGTGGTGGAGG + Exonic
981627632 4:146777000-146777022 GGTGGTGGTGGCGGTGGTGCAGG + Intronic
981702123 4:147618254-147618276 GCTACAGGTGGAGGTGGGACCGG + Intronic
981866080 4:149420600-149420622 GGTCCATGTGCAGGATGTGCAGG - Intergenic
981968409 4:150634888-150634910 GGTCTAGGGGGCAGTGGTGCAGG - Intronic
982199130 4:152943151-152943173 GGAGGAGGTGGAGGAGGTGCTGG - Exonic
983345553 4:166522765-166522787 GCTCCTGGGGGAGGTGGTTCTGG - Intergenic
983448057 4:167878513-167878535 GCTCCTGGGGGAGGTGGTTCTGG - Intergenic
983818887 4:172168586-172168608 GGTGGAGGTGGTGGTGGTGGTGG + Intronic
984682864 4:182630673-182630695 GGTGCAGGTGCAGGATGTGCAGG - Intronic
984847797 4:184122422-184122444 GGTTCTGGTGGTGGTGGTGGTGG - Intronic
985652248 5:1112472-1112494 GGCCCAGCAGGAGGGGGTGCAGG - Intergenic
985733190 5:1563064-1563086 GGCCCAGCTGGAGCTGCTGCGGG - Intergenic
985894180 5:2739314-2739336 GGTCCTGGGGGCGGCGGTGCCGG + Intergenic
986182836 5:5409564-5409586 GGAGCAGGTGGATGTGGGGCAGG - Intergenic
986335147 5:6749134-6749156 GCTGCAGGTGCTGGTGGTGCTGG + Intronic
986400045 5:7371538-7371560 GGTGACGGTGGAGGTGGTGGTGG - Intergenic
986400096 5:7371779-7371801 GGTGGTGGTGGAGGTGGTGGTGG - Intergenic
986400133 5:7371944-7371966 GGTGGTGGTGGAGGTGGTGGTGG - Intergenic
986400232 5:7372405-7372427 GGTGATGGTGGAGGTGGTGGTGG - Intergenic
986400251 5:7372489-7372511 GGTGGAGGTGGTGGTGGTGGTGG - Intergenic
986400253 5:7372495-7372517 GGTGATGGTGGAGGTGGTGGTGG - Intergenic
986400258 5:7372510-7372532 GGTGGAGGTGGTGGTGGTGATGG - Intergenic
986400259 5:7372516-7372538 GGTGATGGTGGAGGTGGTGGTGG - Intergenic
986400296 5:7372654-7372676 GGTGATGGTGGAGGTGGTGGTGG - Intergenic
986400305 5:7372690-7372712 GGTGGAGGTGGTGGTGGTGGTGG - Intergenic
986400307 5:7372696-7372718 GGTGGTGGTGGAGGTGGTGGTGG - Intergenic
986400310 5:7372705-7372727 GGTGGAGGTGGTGGTGGTGGAGG - Intergenic
986400312 5:7372711-7372733 GGTGATGGTGGAGGTGGTGGTGG - Intergenic
986400343 5:7372851-7372873 GGTACAGGTGGTGGTGGTGATGG - Intergenic
987078084 5:14403016-14403038 GGTACAGGTTGTGGTGGTGAAGG + Intronic
987078099 5:14403080-14403102 GGTACAGGTTGTGGTGGTGAGGG + Intronic
987078111 5:14403134-14403156 GGTGCAGGTTGTGGTGGTGAGGG + Intronic
987078188 5:14403480-14403502 GGTGCAGGTGGTGGTGGTGAGGG + Intronic
987078194 5:14403501-14403523 GGTGTAGGTGGTGGTGGTGAGGG + Intronic
987078206 5:14403555-14403577 GGTGCAGGTTGTGGTGGTGAGGG + Intronic
987078255 5:14403747-14403769 GGTGCAGGTGGTGGTGGTGAGGG + Intronic
987078293 5:14403894-14403916 GGTGCAGGTGGTGGTGGTGAGGG + Intronic
987078299 5:14403915-14403937 GGTGTAGGTGGTGGTGGTGAGGG + Intronic
987078311 5:14403969-14403991 GGTACAGGTGGTGAGGGTGCAGG + Intronic
987078334 5:14404074-14404096 GGTGCAGGTTGTGGTGGTGAGGG + Intronic
987876212 5:23684892-23684914 GGTACAGGTGCAGGATGTGCAGG + Intergenic
988143018 5:27267278-27267300 GGACCAGGTGCAGGCGGAGCAGG + Intergenic
988434206 5:31154504-31154526 GGTTGTGGTGAAGGTGGTGCTGG - Intergenic
988898793 5:35708665-35708687 GGTAGAGGTGGTGATGGTGCTGG - Intronic
988902276 5:35745925-35745947 TGTTCTGGTGGAGGTGGTGAGGG - Intronic
988976451 5:36521254-36521276 GGTGGTGGTGGAGGTGGTGATGG + Intergenic
989207371 5:38824461-38824483 GGTGCTGGTGGTGGTGGTGGTGG - Intergenic
989207376 5:38824476-38824498 GGTGCTGGTGGTGCTGGTGCTGG - Intergenic
989207377 5:38824482-38824504 GGTGCTGGTGCTGGTGGTGCTGG - Intergenic
989207381 5:38824503-38824525 GGTGGTGGTGGTGGTGGTGCTGG - Intergenic
989681690 5:44037078-44037100 GGTACATGTGCAGGTTGTGCAGG + Intergenic
989780687 5:45262000-45262022 GCTGCTGGTGGAGGGGGTGCTGG + Exonic
990025500 5:51182940-51182962 GGTAAAGGTGGAGCTGGTGAGGG + Intergenic
991099574 5:62777736-62777758 GGTCCTGGGGGAGGTGGATCAGG - Intergenic
991602420 5:68366868-68366890 GGTCCTGGTGAAGGTGGAGTGGG + Intergenic
991952166 5:71956770-71956792 GCTTGGGGTGGAGGTGGTGCAGG + Intergenic
992483835 5:77176918-77176940 AGTCTAGCTGGAGGTGGGGCTGG - Intergenic
993166789 5:84366242-84366264 GGTGACGGTGGTGGTGGTGCTGG - Intronic
993308591 5:86299667-86299689 GGTACATGTGGAGGATGTGCAGG + Intergenic
993892611 5:93491380-93491402 GGTGCTGGTGGTGGTGGTGATGG + Intergenic
994321934 5:98404490-98404512 CTTCCAGGTGGAGCTGGGGCTGG + Intergenic
995020114 5:107357565-107357587 GAACCAGGTGGAGGTGGTATGGG + Intergenic
995698513 5:114906343-114906365 AGTCCAGGTTGAGGTGGTCTTGG - Intergenic
995784741 5:115816295-115816317 GGTCAATGTAGAGGAGGTGCAGG - Exonic
996124095 5:119705825-119705847 TGTTCTGGTGGAGGTGGTGTGGG + Intergenic
996663175 5:126027646-126027668 GGTGCTGGTGGAGGTGGAGCTGG - Intergenic
996663202 5:126027791-126027813 GGTCATGTTGGAGGTGGTGTTGG - Intergenic
996841848 5:127855095-127855117 GGTCAGGGTGGTGGTGGTGGTGG + Intergenic
997356707 5:133267184-133267206 GGTCTGGGAGGAGGAGGTGCAGG + Intronic
997454324 5:134005879-134005901 GGGCCCTGTGGAGGAGGTGCCGG + Intergenic
997503697 5:134398827-134398849 GGGCTAGGTGGTGGTGGTGTTGG - Intergenic
998364352 5:141619085-141619107 GGTCCGGGCGGAAGTGGGGCAGG - Intergenic
998368407 5:141645821-141645843 GGCCCAGGATGAGGTGGAGCAGG - Exonic
998483916 5:142485446-142485468 AGTCCAAGAGGAGGTGGTGGAGG - Intergenic
999127776 5:149259099-149259121 GGGCCAGTTGGAAGTGGTGGAGG - Exonic
999315239 5:150579364-150579386 GGTCAAGGTGGTGGGGGTGCAGG - Intergenic
999731672 5:154480023-154480045 GGTGCATGGGGGGGTGGTGCAGG + Intergenic
1001136393 5:169106171-169106193 GGTTCAGGTGCAGGATGTGCAGG - Intronic
1001276349 5:170354380-170354402 GGGCCAGTGGGAGGTGGTGATGG + Intronic
1001748883 5:174112693-174112715 GGTCCAGGTACAGGATGTGCAGG + Intronic
1001825866 5:174744497-174744519 TTTCCAGGTGGAGGTGGGGAAGG + Intergenic
1002044385 5:176533726-176533748 GGTCCAGGTGGAGGATGTCGAGG + Intronic
1002275938 5:178104552-178104574 GCTCTAGGAGGAGGTGGAGCAGG + Intergenic
1002710248 5:181190863-181190885 GGCACAGGTGGAGGCGGCGCTGG - Intergenic
1002909551 6:1478849-1478871 GGTGCAGGTGGAGGTAGTGGTGG + Intergenic
1003041759 6:2694487-2694509 GGTCATGGTGGTGGTGGTGGTGG + Intronic
1003193104 6:3891356-3891378 GGTCCAGGGTGATGTGCTGCAGG - Intergenic
1003202126 6:3970949-3970971 GGTACATGTGGAGGATGTGCAGG - Intergenic
1003881025 6:10479837-10479859 GGTACACGTGTAGGAGGTGCAGG + Intergenic
1003946174 6:11078005-11078027 GCTCCAGGTGTAGGGAGTGCTGG - Intergenic
1004611375 6:17243362-17243384 GGTGGAGGTGGTGGTGGTGGTGG + Intergenic
1004806067 6:19205175-19205197 GGTCATGCTGGAGGTGGTGTTGG + Intergenic
1005070021 6:21853319-21853341 GGTCGTGGTGGTGGTGGTGGTGG + Intergenic
1005243582 6:23856773-23856795 GGTTCTGGTGGAGATGGTACAGG - Intergenic
1005671667 6:28112595-28112617 GGTTCTGGGGGAGGAGGTGCAGG - Intergenic
1005873158 6:29992366-29992388 GGTGCAGGTCAAGGTGCTGCAGG - Intergenic
1006003828 6:30987269-30987291 GGTCCCACTGGAGGTCGTGCTGG - Exonic
1006146828 6:31964336-31964358 GGTCAAGGTGCATGTGGTGGTGG + Exonic
1006427745 6:33976675-33976697 TGTCCAGGGGGAGGTGGTGATGG - Intergenic
1006716531 6:36124043-36124065 GGAGGAGGTGGAGGAGGTGCAGG + Intergenic
1006956667 6:37879355-37879377 GGAGCGGGTGGTGGTGGTGCAGG + Intronic
1007231799 6:40353487-40353509 GGACCAGGTGGTGGAGATGCTGG - Intergenic
1007243707 6:40444990-40445012 GGGTGAGGTGGAGGGGGTGCAGG - Intronic
1007282466 6:40722627-40722649 GGCCCAGGTGGGGGTGTTGCAGG - Intergenic
1007641018 6:43339646-43339668 GGTGGAGGTGGGGGTGGTGGAGG + Exonic
1007780104 6:44247743-44247765 AGTCCCGGTGGAGGAGGGGCGGG + Intronic
1007892703 6:45310532-45310554 TGTTCTGGTGGAGGTGGTGGAGG - Intronic
1008838607 6:55869300-55869322 TGTACAGGTGGAGGAGATGCTGG - Intronic
1008951870 6:57170697-57170719 GTTCCAGGTGGAGGAGGTTAAGG + Intergenic
1009532790 6:64842603-64842625 GGTCCAGGCTGAGGTGGTCTCGG + Intronic
1010781636 6:79951708-79951730 GATTCTGGTGGAGGTGGTGGCGG - Intergenic
1011192130 6:84740177-84740199 AGGCCAGGTGGAGCAGGTGCAGG - Intronic
1011443019 6:87407929-87407951 GGGCCAGGTGGGGGTGGGGCGGG - Intergenic
1012441991 6:99269406-99269428 GGTCGTGGTGGTGGTGGTGATGG + Intergenic
1012793796 6:103734664-103734686 TGTTCTGGTGGAGGTGGTGGGGG - Intergenic
1012922726 6:105235725-105235747 TGTTCCGGTGGAGGTGGTGGAGG - Intergenic
1012979315 6:105812992-105813014 GGTCCATGTGCAGGATGTGCAGG - Intergenic
1014005947 6:116418404-116418426 GGTCCAGGGGATGGTGGTTCTGG - Intronic
1014375263 6:120664496-120664518 GGTACAGGTGCAGGATGTGCAGG + Intergenic
1014547235 6:122747770-122747792 GGTGGAGGTGGAGGTGCTGTGGG + Intergenic
1014612081 6:123558884-123558906 GGTCCTGGGGGAGGAGGTTCTGG - Intronic
1015496850 6:133891491-133891513 GCTCGAGGTGGTGGTGGTGCTGG - Intronic
1015877920 6:137842756-137842778 TGTTCTGGTGGAGGTGGTGGAGG + Intergenic
1016556961 6:145349689-145349711 GGTTGAGGTGGAGGTGGAGGAGG - Intergenic
1017429218 6:154354407-154354429 GGTGGTGGTGGAGGTGGTGGTGG - Intronic
1017963411 6:159242456-159242478 GGTACAGGTGCAGGATGTGCAGG - Intronic
1018062792 6:160103656-160103678 GGTGCAGATGGGGGTGGGGCTGG + Intronic
1018156735 6:160992022-160992044 GGTTCCGGTGGCGGTGGTGGCGG - Exonic
1018495404 6:164342201-164342223 GCTCCTGGTGGAGGAGGTTCTGG + Intergenic
1018851222 6:167641466-167641488 GGTGGAGGTGGTGGTGGTGGTGG - Intergenic
1019278146 7:186882-186904 GGTCCAGGTGGGGGTGCTGGAGG - Intergenic
1019440992 7:1046704-1046726 GGACAAGGTGGAGGTGGGGCAGG + Intronic
1019626392 7:2018030-2018052 GGCCCTGTTGGAGGTGCTGCAGG + Intronic
1020279367 7:6642625-6642647 GGCCGAGGTGGAGGTGGAGGCGG + Exonic
1020434972 7:8152542-8152564 GGTGGTGGTGGAGGTGGTGATGG - Intronic
1020860835 7:13489836-13489858 TGTTCTGGTGGAGGCGGTGCCGG - Intergenic
1021462584 7:20905308-20905330 GGTCCATGTGCAGGACGTGCAGG - Intergenic
1021586230 7:22211835-22211857 GGGCCAGGTGAAGAAGGTGCAGG - Intronic
1022199606 7:28103733-28103755 GGTCCAGGTGGTAGTTGTGAAGG - Intronic
1022228393 7:28387769-28387791 GGTCCATGTGCAGGATGTGCAGG - Intronic
1022572795 7:31470495-31470517 GCTCCTGGGGGAGGTGGTTCTGG + Intergenic
1023254923 7:38303714-38303736 GGTGAAGGTGGAGGTGGAGGCGG + Intergenic
1023435139 7:40134503-40134525 GGTCCGGGTGGAGGAGGTTGGGG - Exonic
1023629232 7:42147107-42147129 GGTTGGGGGGGAGGTGGTGCGGG + Intronic
1024265077 7:47600213-47600235 GGGCCAGGTGGTGGTGGGCCAGG - Intergenic
1024559107 7:50628556-50628578 TGCCCAGGTGGGGGTGGTGGGGG + Intronic
1024569711 7:50713663-50713685 GGAGGAGGTGGAGGTGGTGGTGG - Intronic
1024569749 7:50713822-50713844 GGACGAGGTGGAGGTGATGGTGG - Intronic
1024865006 7:53895780-53895802 GGTCCAGGTAGAGCCGCTGCAGG - Intergenic
1025228504 7:57183078-57183100 GGTGCAGGTGGTGGTGGAGGTGG - Intergenic
1025228506 7:57183084-57183106 GGTGGAGGTGCAGGTGGTGGTGG - Intergenic
1025228511 7:57183102-57183124 GGTGGAGGTGGAGGTGGAGGTGG - Intergenic
1026003459 7:66581511-66581533 GATCCAGGTGAAGGAGATGCTGG - Intergenic
1026292515 7:69020523-69020545 GGTGGTGGTGGAGGTGGTGGTGG + Intergenic
1026292517 7:69020529-69020551 GGTGGAGGTGGTGGTGGTGGTGG + Intergenic
1026361209 7:69601558-69601580 GGTGGTGGTGGTGGTGGTGCAGG + Intronic
1026539453 7:71267716-71267738 GGTACAGGTGCAGGAGGTACAGG + Intronic
1026638445 7:72104421-72104443 GGTCCATGTGCAGGATGTGCAGG + Intronic
1026823568 7:73566510-73566532 GGTCCATGTGCAGGATGTGCAGG + Intergenic
1027019344 7:74800769-74800791 GGTCCATGTGCAGGATGTGCAGG - Intronic
1027068682 7:75145172-75145194 GGTCCATGTGCAGGATGTGCAGG + Intronic
1027425399 7:78056787-78056809 GGTCCATGTGCAGGATGTGCAGG - Intronic
1027989813 7:85343550-85343572 GGTGGTGGTGGTGGTGGTGCTGG + Intergenic
1028094277 7:86741072-86741094 GGTCTGGGTGGAGATGGTCCAGG - Intronic
1028589913 7:92483256-92483278 GATCCTGGGGGAGGTGGTCCTGG + Intergenic
1028770316 7:94612771-94612793 GGAACAGGTGGAGGTGGGGTGGG - Intronic
1028985579 7:97006235-97006257 GGTGCTGGTGGTGGTGGTGGTGG - Exonic
1029196809 7:98811069-98811091 GGTGGAGGTGGCGGTGGTGGTGG + Intergenic
1029608777 7:101615487-101615509 GGTGCGGGTGGAGGTGGTGTAGG - Intronic
1030005306 7:105112647-105112669 GGTCCTGGAGCAGGTGGTGGTGG - Exonic
1030638880 7:111981487-111981509 GGTACATGTGCAGGTTGTGCAGG - Intronic
1031118939 7:117698700-117698722 GGTACAGGTCTAGCTGGTGCAGG - Intronic
1031361637 7:120856246-120856268 GGACGAGGGGGAGGTGGTGGTGG - Intronic
1031422458 7:121567447-121567469 GCTCCTGGGGGAGGTGGTTCTGG + Intergenic
1031599752 7:123692540-123692562 GGCCCAGGAGGAGGTGGAGGTGG + Exonic
1031599760 7:123692552-123692574 GGTGGAGGTGGAGGCGGTGGGGG + Exonic
1031709870 7:125032120-125032142 GGTACATGTGCAGGTTGTGCAGG + Intergenic
1031887894 7:127259608-127259630 GGTGAAGGTGGTGGTGGTGGTGG - Intergenic
1031972461 7:128074495-128074517 GTCCCAGGTGGAGGTGGAGGTGG + Exonic
1032514150 7:132494588-132494610 GGTGGTGGTGGAGGTGGTGTGGG + Intronic
1032922585 7:136566693-136566715 GGTAGAGGTGGTGGTGGGGCGGG + Intergenic
1033231341 7:139600443-139600465 CTTCCGGGAGGAGGTGGTGCTGG + Exonic
1033436419 7:141337167-141337189 GGTGCTGGTGGTGGTGGTGGTGG - Intronic
1033465037 7:141582253-141582275 GTTCCTGGGGGAGGTGGTCCTGG + Intronic
1033625584 7:143107064-143107086 GATCCTGGGGGAGGTGGTCCTGG - Intergenic
1034055986 7:148035482-148035504 GGCCCAGGTGCAGCTGGTGCTGG + Intronic
1034189904 7:149205977-149205999 GGTCCAAGTTGAGGTCGTGCTGG + Intronic
1034202954 7:149294004-149294026 GGCCCAGATGAAGGTGCTGCTGG + Intronic
1034350814 7:150413672-150413694 GGACTGGGTGGAGGTGGAGCAGG + Intergenic
1035013266 7:155739876-155739898 GGTGGTGGTGGTGGTGGTGCTGG - Exonic
1035035402 7:155891221-155891243 GGAGGTGGTGGAGGTGGTGCAGG + Intergenic
1035035420 7:155891301-155891323 GGAGGTGGTGGAGGTGGTGCAGG + Intergenic
1035035438 7:155891379-155891401 GGTAAAGGTGGTGGTGGTGTAGG + Intergenic
1035035457 7:155891459-155891481 GGTAAAGGTGGTGGTGGTGTAGG + Intergenic
1035035579 7:155891987-155892009 GGTGGTGGTGGAGGTGGTGGTGG + Intergenic
1035035600 7:155892086-155892108 GGTGGTGGTGGAGGTCGTGCAGG + Intergenic
1035035661 7:155892365-155892387 GGTGGAGGTGGAGGTGGTGGTGG + Intergenic
1035035680 7:155892454-155892476 GATGGTGGTGGAGGTGGTGCAGG + Intergenic
1035035724 7:155892654-155892676 GGTGGTGGTGGAGGTGGTGGAGG + Intergenic
1035038711 7:155911980-155912002 GGTGCAGGAGGGCGTGGTGCTGG - Intergenic
1035326955 7:158071564-158071586 GCTCCTGGTGGAGGTGCTCCTGG + Intronic
1035326959 7:158071579-158071601 GCTCCTGGTGGAGGTGCTCCTGG + Intronic
1035380997 7:158440883-158440905 GGTGAAGGTGGTGGTGGTGACGG + Intronic
1035493019 7:159296299-159296321 GGCTCAGGTGGGGGTGCTGCAGG - Intergenic
1035910878 8:3565047-3565069 GGTCCATGTGCAGGATGTGCAGG - Intronic
1036133341 8:6136550-6136572 GGTGCGGGTGGTGGTGGTGGGGG - Intergenic
1036687902 8:10924090-10924112 GGCCCAGGAGGAGGAGGGGCTGG - Intronic
1036778404 8:11629124-11629146 GGCCCAGGTGGAGGTACTTCAGG + Intergenic
1036961198 8:13246132-13246154 GTTCTAGGTGGAAGTGTTGCTGG - Intronic
1037713551 8:21376231-21376253 TGTTCAGCTGGAGGTGGTGGGGG + Intergenic
1037862496 8:22415819-22415841 GGACCAGGAGGAGGGGGTGATGG + Exonic
1038202023 8:25421756-25421778 GGTCAAGGGGGATGTGGGGCTGG + Intronic
1038534624 8:28344874-28344896 GTTCGAGGTGGTGGTGGGGCAGG - Intergenic
1038591986 8:28847470-28847492 GGTGGAGGTGGAGGTGGTAGTGG - Intronic
1038988435 8:32838832-32838854 GGTACATGTGCAGGTTGTGCAGG - Intergenic
1039079717 8:33722730-33722752 GGCCCAGGTCCTGGTGGTGCTGG + Intergenic
1039173281 8:34773613-34773635 GGACCAGCTGGAGGAGGTGATGG - Intergenic
1039657359 8:39424102-39424124 GGTCCAGGTTGAGGTGATCTTGG - Intergenic
1040542936 8:48376141-48376163 GGTACAGGGGGAGGTGGAGCAGG - Intergenic
1041185080 8:55290579-55290601 GGGCCTGTTGGGGGTGGTGCAGG - Intronic
1041193508 8:55377091-55377113 TTTCCAGGTGGTGGTGGTGGCGG - Intronic
1041645099 8:60243518-60243540 GGGCAAGGAGGAGGTGGTGATGG - Intronic
1042490106 8:69387509-69387531 GGTCCATGTGCAGGATGTGCAGG - Intergenic
1042516349 8:69663109-69663131 TCTCCAGGTTGAGGTGGGGCTGG - Intergenic
1042894456 8:73651340-73651362 GGCCCAGGTACTGGTGGTGCTGG - Intronic
1043466586 8:80513987-80514009 AGTCAAGATGGAGGTGATGCTGG + Exonic
1044344757 8:91092263-91092285 AGACCAGGTGGAGATGGTGGTGG - Intergenic
1044554630 8:93549636-93549658 GGTACATGTGCAGGAGGTGCAGG - Intergenic
1044654655 8:94534883-94534905 GGTGGCGGTGGAGGTGGTGGTGG + Exonic
1045243971 8:100426643-100426665 GGTAAAGGTGGTGGTGGTGGTGG - Intergenic
1045417141 8:101978639-101978661 TGTGCAGGTGGTGGTGGTGGTGG + Intronic
1045800441 8:106095393-106095415 GGTCTAGTTGGTGGTGGTTCTGG - Intergenic
1046561783 8:115847005-115847027 GGTACACGTGCAGGTTGTGCAGG + Intergenic
1047085943 8:121515244-121515266 GGTACATGTGCAGGTTGTGCAGG + Intergenic
1047682899 8:127273073-127273095 TGTCCAGGTGGAGGGTGTCCAGG - Intergenic
1047748093 8:127860188-127860210 GGTCCTGGTGGCGGAGGTGCTGG + Intergenic
1047807274 8:128373537-128373559 GGTGCTGGTGCAGGTGCTGCTGG + Intergenic
1047807280 8:128373576-128373598 GGTCCTGGTGTTGCTGGTGCAGG + Intergenic
1048496385 8:134939536-134939558 GGGCCAGGCAGAGGTGGGGCTGG - Intergenic
1048588447 8:135798068-135798090 GGTCCTGCTGGAGCTGGGGCAGG + Intergenic
1048802321 8:138205962-138205984 TGTGTAGGTGGAGGTGCTGCTGG - Intronic
1048802342 8:138206100-138206122 TGTGTAGGTGGAGGTGATGCTGG - Intronic
1048923274 8:139249667-139249689 GGTCCAGGCTGAGGTGGTCTTGG + Intergenic
1049040783 8:140110674-140110696 GGTGCAGGGGGAGCTGCTGCAGG - Intronic
1049040791 8:140110698-140110720 GGTTCAGGGGGAGCTGCTGCAGG - Intronic
1049148304 8:141018193-141018215 GCCCCTGGTGGAGGTGGTTCTGG - Intergenic
1049190290 8:141283718-141283740 GGTCCACGTGGAAGTGTGGCTGG - Intronic
1049421731 8:142519617-142519639 GGTGATGGTGGTGGTGGTGCTGG + Intronic
1049421770 8:142519854-142519876 GGTCGTGGTGATGGTGGTGCTGG + Intronic
1049425329 8:142535571-142535593 GGGCCAGGTGGAGGCCATGCCGG + Intronic
1049498859 8:142950417-142950439 GGTGATGGTGGAGGTGGTGGTGG + Intergenic
1049498861 8:142950423-142950445 GGTGGAGGTGGTGGTGGTGGTGG + Intergenic
1049581009 8:143410963-143410985 GGTCATGGTGGTGGTGGTGGTGG + Intergenic
1049600065 8:143503587-143503609 GGTGCTGGGGGAGGTGGTGGTGG - Intronic
1049600077 8:143503619-143503641 GGTGCTGGAGGAGGTGGTGGTGG - Intronic
1049600085 8:143503651-143503673 GGTGCTGGAGGAGGTGGTGGTGG - Intronic
1049600093 8:143503683-143503705 GGTGCTGGGGGAGGTGGTGGTGG - Intronic
1049619712 8:143592544-143592566 GGGCCATGCGCAGGTGGTGCTGG + Intronic
1049682249 8:143924624-143924646 GGCCGAGATGGAGGTGCTGCTGG - Exonic
1049924957 9:399995-400017 GGTGATGGTGGAGGTGGTGGAGG - Intronic
1049924967 9:400028-400050 GGTGGAGGTGGTGGTGGTGATGG - Intronic
1049924968 9:400034-400056 GGTGATGGTGGAGGTGGTGGTGG - Intronic
1049924983 9:400091-400113 GGTGGAGGTGGTGGTGGTGATGG - Intronic
1049924984 9:400097-400119 GGTGGTGGTGGAGGTGGTGGTGG - Intronic
1049924999 9:400157-400179 GGTGATGGTGGAGGTGGTGGTGG - Intronic
1049925063 9:400403-400425 GGTGGAGGTGGTGGTGGTGATGG - Intronic
1049925064 9:400409-400431 GGTGATGGTGGAGGTGGTGGTGG - Intronic
1049925089 9:400503-400525 GGTGGAGGTGGTGGTGGTGATGG - Intronic
1049925090 9:400509-400531 GGTGATGGTGGAGGTGGTGGTGG - Intronic
1049925103 9:400560-400582 GGTGGAGGTGGTGGTGGTGATGG - Intronic
1049925104 9:400566-400588 GGTGATGGTGGAGGTGGTGGTGG - Intronic
1049925114 9:400599-400621 GGTGGAGGTGGTGGTGGTGATGG - Intronic
1049925138 9:400692-400714 GGTGGAGGTGGTGGTGGTGGTGG - Intronic
1049925140 9:400698-400720 GGTGATGGTGGAGGTGGTGGTGG - Intronic
1049925145 9:400713-400735 GGTGGAGGTGGTGGTGGTGATGG - Intronic
1049925146 9:400719-400741 GGTGGTGGTGGAGGTGGTGGTGG - Intronic
1049925158 9:400767-400789 GGTGGAGGTGGTGGTGGTGGTGG - Intronic
1049925160 9:400773-400795 GGTGATGGTGGAGGTGGTGGTGG - Intronic
1051547892 9:18296986-18297008 GAGCCTGGTGGAGGTGGTGGTGG - Intergenic
1052623339 9:30943349-30943371 GGTACATGTGGAGGATGTGCAGG - Intergenic
1052763266 9:32614327-32614349 GGTGTTGGTGGTGGTGGTGCTGG - Intergenic
1053173423 9:35906575-35906597 GGTGGTGGTGGAGGTGGTGAGGG - Exonic
1054711812 9:68518010-68518032 GGTCCAGGTGGAGGAGGATCTGG + Intronic
1055168308 9:73223617-73223639 GGTCAGGCTGGAGGTGGTGTTGG - Intergenic
1055626719 9:78183050-78183072 GCTCCTGGGGGAGGTGGTTCTGG - Intergenic
1057072878 9:92115325-92115347 GGTTCTGGTGGAGATGGTACAGG - Exonic
1057266551 9:93621473-93621495 GGCCCAGGGGTGGGTGGTGCTGG + Intronic
1057276083 9:93676682-93676704 GGTGGAGGTGGAGGTGGTGCCGG - Exonic
1057336144 9:94156688-94156710 GGTCCTTGTGCTGGTGGTGCTGG - Intergenic
1057444955 9:95107248-95107270 GGTCCAGGTGAAGGCCGTGCTGG - Exonic
1058612399 9:106790440-106790462 GCTCCTGGGGGAGGTGGTTCTGG - Intergenic
1058666697 9:107324897-107324919 GGTCAAGGAGGAGGAGGTGGAGG + Exonic
1059318851 9:113450571-113450593 TGTCAAGGCAGAGGTGGTGCTGG + Intronic
1059332261 9:113543001-113543023 GCTCCAGCTGGAGGTGCAGCAGG - Intronic
1059518356 9:114916524-114916546 AGTCTGGGTGGAGGTGGTGGTGG + Intronic
1060231816 9:121831001-121831023 GATACTGGTGGAGGTGGTGAGGG + Intronic
1060759987 9:126238859-126238881 GGACCAGGTGGTGGTGGTGGAGG + Intergenic
1061256049 9:129454501-129454523 GGTGGAGGTGGAGGTGGTGGAGG + Intergenic
1061422016 9:130477747-130477769 CTTCCTGGAGGAGGTGGTGCTGG + Intronic
1061961329 9:133990770-133990792 GGTGCAGGTGGCGGGGGTGGCGG - Intronic
1062098402 9:134714724-134714746 GATGCTGGTGGAGGTGGTGATGG + Intronic
1062150228 9:135014368-135014390 GGTGCAGGTGGAGGCAGGGCTGG - Intergenic
1062318528 9:135979499-135979521 GGTCCAGGGGAAGGGGGTGGGGG - Intergenic
1062380700 9:136285329-136285351 GGACCCGGAGCAGGTGGTGCTGG - Intronic
1062392960 9:136341267-136341289 GCTCCAGGGGGAGGTGGGGGTGG - Intronic
1062453703 9:136626190-136626212 GGGCCAGCTGGAGCGGGTGCAGG + Intergenic
1062471943 9:136709989-136710011 GGGCCAGGGGGAGTGGGTGCAGG - Intergenic
1062624024 9:137434949-137434971 GGCCCTGGTGGCGGTGGTGGGGG - Exonic
1062698669 9:137888135-137888157 GATCCAGGTGGGAGTGGTGAGGG + Intronic
1185593143 X:1291749-1291771 GGTCCAGGTGGAGGTGGTACAGG - Intronic
1185593153 X:1291793-1291815 GATCCAGGTGGACGTGGAGTAGG - Intronic
1185593169 X:1291878-1291900 GGTCCAGGTGGACGTGGAGTAGG - Intronic
1185593187 X:1291963-1291985 GGTCCAGGTGGAGGTGGTGCAGG - Intronic
1185593211 X:1292088-1292110 GGTCCAGGTGGAGGTGGTGCAGG - Intronic
1185593221 X:1292132-1292154 GGTCCAGGTGGACGTGGAGTAGG - Intronic
1185593245 X:1292260-1292282 GGTCCAGGTAGAGGTGGGGCAGG - Intronic
1185593457 X:1293610-1293632 GGTCCAGGTGGAGGTGGGGCAGG - Intronic
1185593477 X:1293697-1293719 GGTCCAGGTGGAGATGGGGCAGG - Intronic
1185593488 X:1293741-1293763 GGTCCAGGTGGATGTGGACTAGG - Intronic
1185593497 X:1293784-1293806 GGTCCAGGTGGAGGTGGGGCAGG - Intronic
1185593518 X:1293870-1293892 GGTCCAGGTGGAGGTGGGGCAGG - Intronic
1185593547 X:1294000-1294022 GGTCCAGGTGGAGGTGGGGCAGG - Intronic
1185593567 X:1294084-1294106 GGTCCAGGTAGAGGTGGGGCAGG - Intronic
1185593579 X:1294127-1294149 GGTCCAGGTGGAGATGGGGCAGG - Intronic
1185593590 X:1294171-1294193 GGTCCAGGTGGAGGTGGAGTAGG - Intronic
1185593599 X:1294208-1294230 GGTCCAGGTGGAGGTGGAGTAGG - Intronic
1185593727 X:1294795-1294817 GGTCCAGGTAGACATGGGGCAGG - Intronic
1185593737 X:1294838-1294860 GGTGTAGGTGGAGGTGGGGTCGG - Intronic
1185593905 X:1295726-1295748 GGTCTCTGTGGAGGTGGGGCAGG - Intronic
1185594704 X:1298870-1298892 GATCCAGGTAGACGTGGGGCAGG - Intronic
1187082540 X:16006574-16006596 GGTACAGGTGCAGGATGTGCAGG + Intergenic
1187396570 X:18924495-18924517 GGGCCAGGTAGAAGTGATGCTGG + Exonic
1188141561 X:26557949-26557971 GGCCCAGGTACTGGTGGTGCCGG - Intergenic
1188229808 X:27647530-27647552 GGTACATGTGGAGGATGTGCAGG - Intronic
1189003612 X:36971977-36971999 GGCCCAGGTGGAGGAACTGCAGG + Intergenic
1189046024 X:37591918-37591940 GGCCCAGGTGGAGGAACTGCAGG - Intronic
1189252953 X:39615032-39615054 GAACCAGGTGGTGGTGGTGAGGG + Intergenic
1189290710 X:39883767-39883789 GGTGGAGGTGGTGGTGGTGGTGG + Intergenic
1189413645 X:40794826-40794848 TGTTCTGGTGGAGGTGGTGGAGG - Intergenic
1189907554 X:45777155-45777177 GGTGGAGGTGGAGGTGGAGGTGG + Intergenic
1190328343 X:49220439-49220461 GGGCCAGGTGGAGCAGGTGTGGG - Intronic
1190713334 X:53084730-53084752 GCTCCAGGTGGGGGTGATGGTGG - Intronic
1190726369 X:53193155-53193177 GGTCCAGGAGGAGGAAGAGCTGG - Exonic
1190750467 X:53357551-53357573 GGTCCAGGGTGGGGTGGGGCTGG + Intergenic
1190981202 X:55457952-55457974 GGGGCAGGTGGTGGTGGTGGTGG + Intergenic
1190987496 X:55515228-55515250 GGGGCAGGTGGTGGTGGTGGTGG - Intergenic
1191250468 X:58257768-58257790 AGGCCAGGTGCAGGTGATGCTGG - Intergenic
1191251019 X:58260263-58260285 GGGCCTGGTGCAGGTGCTGCTGG - Intergenic
1191255435 X:58277618-58277640 GGGTCAGGTGCAGGTGCTGCTGG + Intergenic
1191642406 X:63441694-63441716 GGTCATGCTGGAGATGGTGCTGG - Intergenic
1191933784 X:66404598-66404620 GGTCGTGCTGGAGGTGGTGGTGG + Intergenic
1192201441 X:69068995-69069017 GGTCCAGGAGGAAGTGGGGAAGG - Intergenic
1193359241 X:80561363-80561385 GGTCCAAGAGGTGGTGGTCCTGG - Intergenic
1193610946 X:83631042-83631064 GGTGCTGGTGGAGGTGGGGCTGG + Intergenic
1193692330 X:84660880-84660902 GGTACAGGTGCAGGATGTGCAGG - Intergenic
1194229901 X:91308563-91308585 GGTACAGGTGCAGGATGTGCAGG - Intergenic
1194521127 X:94919813-94919835 TGTCCAGTTTCAGGTGGTGCTGG - Intergenic
1194926867 X:99836240-99836262 TGTTCTGGTGGAGGTGGTGGAGG + Intergenic
1195291158 X:103432995-103433017 GTTCCTGGGGGAGGTGGTCCTGG + Intergenic
1195326860 X:103765241-103765263 GTTCCTGGTGGAGGTGGTCCTGG + Intergenic
1195803025 X:108734435-108734457 GGTGGAGGAGGAGGTGGTGGAGG + Exonic
1196737541 X:118992773-118992795 TGTTCTGGTGGAGGTGGTGGTGG - Intronic
1196929722 X:120669441-120669463 TGTCCAGGAGGAGGGGGTGCAGG - Intergenic
1197588960 X:128384506-128384528 TGTTCTGGTGGAGGTGGTGGTGG - Intergenic
1197666549 X:129230141-129230163 GGTTGTGGTGGTGGTGGTGCTGG - Intergenic
1198096005 X:133380337-133380359 GGTGGGGGTGGGGGTGGTGCGGG - Intronic
1199057801 X:143318779-143318801 TGTTCTGGTGGAGGTGGTGGGGG + Intergenic
1199118032 X:144015614-144015636 GGTACAGGTGCAGGAAGTGCAGG - Intergenic
1199224495 X:145356723-145356745 GGTCCATGTGCAGGATGTGCAGG + Intergenic
1199486514 X:148354180-148354202 GGTACATGTGGAGGAGGTACAGG - Intergenic
1199668581 X:150121545-150121567 TGTTCAAGTGGAGGTGGTGGTGG - Intergenic
1199762121 X:150912966-150912988 GAGCCAGGTGGAGGTGGTGGCGG - Intergenic
1200684474 Y:6246481-6246503 GGCGGAGGTGGAGGTGGTGGCGG + Exonic
1200684509 Y:6246610-6246632 CGTTCAGGTGGAGCTGGAGCCGG + Exonic
1200687154 Y:6266925-6266947 CGTTCAGGTGGAGCTGGAGCCGG + Intergenic
1200831038 Y:7689194-7689216 TGTTCAGGTGGAGCTGGAGCCGG - Intergenic
1200942950 Y:8804475-8804497 GGTGAAGGTGGAGGTGCTGTGGG - Intergenic
1200989997 Y:9337722-9337744 GGCGGAGGTGGAGGTGGTGGCGG + Exonic
1200990003 Y:9337740-9337762 GGCGGAGGTGGAGGTGGTGGCGG + Exonic
1200990038 Y:9337869-9337891 CGTTCAGGTGGAGCTGGAGCCGG + Exonic
1200992665 Y:9358055-9358077 GGCGGAGGTGGAGGTGGTGGCGG + Exonic
1200992700 Y:9358184-9358206 CGTTCAGGTGGAGCTGGAGCCGG + Exonic
1200995319 Y:9378334-9378356 GGCGGAGGTGGAGGTGGTGGCGG + Intronic
1200995354 Y:9378463-9378485 CGTTCAGGTGGAGCTGGAGCCGG + Intronic
1200997983 Y:9398679-9398701 GGCGGAGGTGGAGGTGGTGGCGG + Exonic
1200998018 Y:9398808-9398830 CGTTCAGGTGGAGCTGGAGCCGG + Exonic
1201000492 Y:9467213-9467235 GGCGGAGGTGGAGGTGGTGGCGG + Exonic
1201000528 Y:9467342-9467364 CGTTCAGGTGGAGCTGGAGCCGG + Exonic
1201003154 Y:9487525-9487547 GGCGGAGGTGGAGGTGGTGGCGG + Exonic
1201003160 Y:9487543-9487565 GGCGGAGGTGGAGGTGGTGGCGG + Exonic
1201003195 Y:9487672-9487694 CGTTCAGGTGGAGCTGGAGCCGG + Exonic
1201005813 Y:9507808-9507830 GGCGGAGGTGGAGGTGGTGGCGG + Intergenic
1201005819 Y:9507826-9507848 GGCGGAGGTGGAGGTGGTGGCGG + Intergenic
1201005852 Y:9507954-9507976 CGTTCAGGTGGAGCTGGAGCCGG + Intergenic
1201008473 Y:9528138-9528160 GGCGGAGGTGGAGGTGGTGGCGG + Exonic
1201008508 Y:9528267-9528289 CGTTCAGGTGGAGCTGGAGCCGG + Exonic
1201011092 Y:9548436-9548458 CGTTCAGGTGGAGCTGGAGCCGG + Intergenic
1201048123 Y:9907785-9907807 CGTTCAGGTGGAGCTGGAGCCGG - Intergenic
1201063493 Y:10068905-10068927 GGTGGAGGTGGAGGTGGAGGTGG - Intergenic
1201063495 Y:10068911-10068933 GGTGGAGGTGGAGGTGGAGGTGG - Intergenic
1201063497 Y:10068917-10068939 GGTGGAGGTGGAGGTGGAGGTGG - Intergenic
1201352184 Y:13055881-13055903 GGTACACGTGGAGGCTGTGCAGG + Intergenic
1202367009 Y:24172492-24172514 GGACAAGGTGGAGGAGCTGCTGG + Intergenic
1202379372 Y:24262267-24262289 TGGGCAGGTGGAGGTGGTGCAGG + Intergenic
1202491410 Y:25407854-25407876 TGGGCAGGTGGAGGTGGTGCAGG - Intergenic
1202503772 Y:25497631-25497653 GGACAAGGTGGAGGAGCTGCTGG - Intergenic
1202597009 Y:26550730-26550752 GGTACATGTGGAGGATGTGCAGG - Intergenic