ID: 1185593443

View in Genome Browser
Species Human (GRCh38)
Location X:1293539-1293561
Sequence CTCTTTGTCTACTCTGTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 305}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185593443_1185593446 2 Left 1185593443 X:1293539-1293561 CCCTACACAGAGTAGACAAAGAG 0: 1
1: 0
2: 3
3: 25
4: 305
Right 1185593446 X:1293564-1293586 GTCCCTACTCCACATTTACCTGG 0: 2
1: 1
2: 1
3: 13
4: 84
1185593443_1185593450 18 Left 1185593443 X:1293539-1293561 CCCTACACAGAGTAGACAAAGAG 0: 1
1: 0
2: 3
3: 25
4: 305
Right 1185593450 X:1293580-1293602 TACCTGGACCCAGTGTAGACAGG 0: 3
1: 14
2: 9
3: 10
4: 116
1185593443_1185593452 21 Left 1185593443 X:1293539-1293561 CCCTACACAGAGTAGACAAAGAG 0: 1
1: 0
2: 3
3: 25
4: 305
Right 1185593452 X:1293583-1293605 CTGGACCCAGTGTAGACAGGAGG 0: 6
1: 6
2: 5
3: 21
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185593443 Original CRISPR CTCTTTGTCTACTCTGTGTA GGG (reversed) Intronic
901170232 1:7251604-7251626 CTGTGTGCCTACTCTGTGCAAGG + Intronic
902274340 1:15328461-15328483 CTCTTTGTCTAATTTTTGTGCGG + Intronic
903002686 1:20277536-20277558 TTCTGTGTCAACTCTGTGTGGGG + Intergenic
904676797 1:32203869-32203891 CTCTTTGCCTACTCTGGGTGGGG - Exonic
904964136 1:34358654-34358676 CTCTTTTTTTACTCAGTGTGGGG + Intergenic
905228982 1:36500605-36500627 GTCTTTTTCTATTCTCTGTAAGG + Intergenic
906632588 1:47384921-47384943 TTATTTATCTACTCTGTGTCAGG - Intergenic
906767733 1:48450207-48450229 CTCTTTTTATACTTTGTTTATGG - Intronic
906779500 1:48559894-48559916 CTCATTGTTTACTGTGTGTCAGG - Intronic
909543077 1:76812696-76812718 CTCTGTTTCTACTCTGGGGATGG + Intergenic
910271330 1:85398132-85398154 GACTTTGTCTACTTTGTCTATGG - Intronic
910917137 1:92301094-92301116 GTCTTTATATACTCTTTGTATGG - Intronic
912281319 1:108317503-108317525 CTCACTGTCTACCCTCTGTAGGG + Intergenic
912715934 1:111983548-111983570 CTCTTTCCCTGCTCTGTGAAGGG + Intronic
915263379 1:154696023-154696045 ATCTCTGTCTCCTATGTGTAAGG + Intergenic
915690427 1:157683577-157683599 CTCCTTGTCTCCACTTTGTAGGG - Intronic
915782650 1:158569929-158569951 TTGTTTGTCTTCTCTGTGTATGG + Intergenic
917608073 1:176656413-176656435 GTCTTTGACAACTCTTTGTATGG + Intronic
918866518 1:189907349-189907371 TTCTTTTTCATCTCTGTGTATGG + Intergenic
921789063 1:219268823-219268845 CTCACAGTCTACCCTGTGTAAGG + Intergenic
924133243 1:240934833-240934855 CTCCTTTTCTCCTGTGTGTATGG + Intronic
924152952 1:241147191-241147213 CTCTTTGACTACTCAGAGAAAGG + Intronic
1063347264 10:5323709-5323731 CTGAGTGTCTACTCTGTGTCAGG + Intergenic
1064160755 10:12943661-12943683 CTCTTTGTGTACTATGTAAATGG + Intronic
1065334714 10:24644800-24644822 GTCTTTGTCCTCTCTGTGTATGG + Intronic
1066642439 10:37569621-37569643 CTCTTTGTCTCTTCTCTTTATGG + Intergenic
1066788954 10:39042377-39042399 GTCTTTGTATAGTCTGTGAAAGG + Intergenic
1066791245 10:39066361-39066383 CTCTTTGTATAATCTGTGAAGGG - Intergenic
1066795763 10:39118791-39118813 CTCTTTGTAGAATCTGTGAAGGG + Intergenic
1066797038 10:39133793-39133815 CTTTTTGTAGACTCTGTGAAGGG + Intergenic
1066798775 10:39159040-39159062 GTTTTTGTCTATTCTGTGAATGG + Intergenic
1066801273 10:39194384-39194406 CTTTTTGTCCATTCTGTGAATGG - Intergenic
1066809278 10:39305094-39305116 CTTTTTGTGTAATCTGTGAAGGG - Intergenic
1066929935 10:41745443-41745465 CTTTTTGTCCATTCTGTGAATGG + Intergenic
1066931864 10:41772182-41772204 ATTTTTGTCCACTCTGTGAATGG + Intergenic
1066932047 10:41775097-41775119 GTCTTTGTCCATTCTGTGAATGG + Intergenic
1066932407 10:41780214-41780236 CTTTTTGTCCATTCTGTGAATGG + Intergenic
1066932463 10:41781065-41781087 CTTTTTGTCCATTCTGTGTATGG + Intergenic
1071985970 10:91050734-91050756 CTATGTGTCTATTCTGTATAGGG - Intergenic
1072141950 10:92596876-92596898 CTCTTTGTTGATTCTGTGTTTGG + Intronic
1075462701 10:122628950-122628972 CTCTTTGTTTACTTTTTCTAAGG - Intronic
1078257201 11:9668597-9668619 CTGTAAGTCTACTATGTGTAAGG + Intronic
1078950115 11:16121645-16121667 ATCTTTCTCTACTCTATCTATGG + Intronic
1080435325 11:32235681-32235703 CTCTTTGCCTTCTCTCTGTTTGG + Intergenic
1082146447 11:48676165-48676187 GTCTTTGTCTATTCTGTGAATGG + Intergenic
1082148708 11:48704412-48704434 CTTTTTGTCCATTCTGTGAATGG - Intergenic
1082185760 11:49178885-49178907 CTTGTTGTCTACTATGTTTAAGG + Intronic
1082295012 11:50430086-50430108 GTTTTTGTCCACTCTGTGAATGG + Intergenic
1082296949 11:50452483-50452505 GTTTTTGTCTATTCTGTGAATGG + Intergenic
1082300942 11:50505226-50505248 CTTTTCGTCTATTCTGTGGATGG - Intergenic
1082309284 11:50626879-50626901 CTTTTTGTCCATTCTGTGAATGG + Intergenic
1082312288 11:50666409-50666431 CTTTTTGTCCATTCTGTGAATGG - Intergenic
1082576065 11:54805066-54805088 CTTTTTGTCTATTCTGTGAATGG - Intergenic
1082582632 11:54892004-54892026 CTTTTTGTCCATTCTGTGAAGGG + Intergenic
1082584301 11:54915845-54915867 GTTTTTGTCTATTCTGTGAATGG - Intergenic
1082584460 11:54918246-54918268 GTCTTTGTCCATTCTGTGAATGG - Intergenic
1082587321 11:54957352-54957374 CTTTTTGTCCATTCTGTGAATGG + Intergenic
1082589295 11:54985954-54985976 GTCTTTGTCTATTCTGTGAATGG + Intergenic
1082591404 11:55015627-55015649 GTTTTTGTCCATTCTGTGTATGG + Intergenic
1082592719 11:55033254-55033276 GTTTTTGTCTACTCTGTGAATGG - Intergenic
1082593875 11:55050121-55050143 GTTTTTGTCCACTCTGTGAATGG - Intergenic
1082595139 11:55069316-55069338 CTTATTGTCTATTCTGTGAAAGG - Intergenic
1084185022 11:67466985-67467007 TTCTGTGTCTACTCTGGGCAAGG - Intronic
1084494196 11:69494718-69494740 CTCCTTGTCTCCTCTGTGGGGGG - Intergenic
1084623774 11:70292559-70292581 CGTATTGTCTACTGTGTGTAAGG + Intronic
1086089232 11:82988668-82988690 GTAGTTGTCTACTCTGTGCAGGG - Intronic
1086219775 11:84428566-84428588 ATCTTTGTCTCCACTGTGTGAGG - Intronic
1092139670 12:6174516-6174538 TTCTTTTTCTACTTTGTGTATGG - Intergenic
1093544088 12:20324913-20324935 CTCTTTTTCTCTTCTTTGTAAGG + Intergenic
1094098648 12:26736953-26736975 CTCTTTGTTTTCTCTCTGTTAGG - Intronic
1094859086 12:34439596-34439618 CTTTTTGTCCAATCTGTGAATGG - Intergenic
1094861751 12:34475562-34475584 CTTTTTGTCCATTCTGTGAATGG - Intergenic
1094863087 12:34493069-34493091 CTTTTTGTCCATTCTGTGAATGG - Intergenic
1094863905 12:34505368-34505390 CTTTTTGTCCATTCTGTGAATGG - Intergenic
1094864014 12:34507258-34507280 CTTTTTGTATAATCTGTGAAGGG - Intergenic
1094866787 12:34543011-34543033 GTTTTTGTCGACTCTGTGAATGG - Intergenic
1094867346 12:34552222-34552244 GTTTTTGTCTATTCTGTGAATGG - Intergenic
1094867600 12:34556168-34556190 CTTTTTGTCCATTCTGTGAATGG - Intergenic
1094867770 12:34558748-34558770 CTTTTTGTCCATTCTGTGAATGG - Intergenic
1094868035 12:34562655-34562677 TTCTTTGTCCATTCTGTGAATGG - Intergenic
1094868112 12:34563780-34563802 CTTTTTGTCCATTCTGAGTATGG - Intergenic
1094868719 12:34573592-34573614 CTTTTCGTCTATTCTGTGAATGG - Intergenic
1095081270 12:38002384-38002406 CTCTTTGGATATTCTGTGAAGGG + Intergenic
1095081998 12:38012748-38012770 CTTTTTGTATAATCTGTGAAGGG + Intergenic
1095235965 12:39796066-39796088 CTACTAATCTACTCTGTGTATGG + Intronic
1095644377 12:44525901-44525923 CTCTTTACCTACTCTTTGCATGG - Intronic
1096477346 12:51916245-51916267 CCCTTTCCCTACCCTGTGTAGGG - Intronic
1096596612 12:52699894-52699916 CTTTTTGTCTTCTCCGTGTTGGG - Intronic
1097349520 12:58533099-58533121 CTCTTCATCTACTCTATGTCTGG + Intergenic
1097485963 12:60200627-60200649 CTCTTTGTCTCATCTGTTGATGG + Intergenic
1098418654 12:70266772-70266794 CTCTTTGTTTACTTTTTGCATGG + Intronic
1098921324 12:76304746-76304768 CTCTTTGTCTTATCTGTGAATGG + Intergenic
1100881786 12:99026498-99026520 CTCTTTGTCTACTCTGGGGAAGG - Intronic
1102489109 12:113278256-113278278 CTCTCTGTCTACTCCTTCTATGG - Intronic
1103112879 12:118296986-118297008 CTCAGTTTCTACTATGTGTATGG + Intronic
1103969632 12:124661958-124661980 CTCTTAGCCTACTCTGCCTAGGG + Intergenic
1106313762 13:28576322-28576344 CTCTTGGTCAGCTCTGTGTTGGG + Intergenic
1107685123 13:42889473-42889495 CTCCTTGTTTACTCTGTCTCTGG + Intronic
1108892894 13:55283626-55283648 CTCTTAGTGTGCTTTGTGTAGGG + Intergenic
1109318606 13:60781980-60782002 TTCTTTCTCAACTCTGTGTGTGG + Intergenic
1112472550 13:99702063-99702085 CTGATTGTCTACTATGTGTTAGG + Intronic
1112651172 13:101400277-101400299 CTGTTTGACTACAATGTGTAAGG + Intronic
1115738895 14:36366054-36366076 GTCTTTTTCTACTTTCTGTAGGG + Intergenic
1116374922 14:44186613-44186635 TTCTTTCTCTACTATGTGAAAGG - Intergenic
1116631153 14:47335580-47335602 CTCTGTGTTTACACTGAGTAAGG + Intronic
1118150685 14:63186726-63186748 CTTTATGTATACTGTGTGTAAGG - Intergenic
1118459835 14:65977602-65977624 CTCCTTGTATGCTCTGTGCATGG - Intronic
1119294418 14:73521393-73521415 CACTCTGTCTATTCTGTGTGTGG + Intronic
1119563424 14:75608777-75608799 CTCATTGTCTTCCCTGGGTATGG + Intronic
1120015599 14:79469851-79469873 CTCTTTGTCTACTCTGAAGAAGG + Intronic
1120241609 14:81956256-81956278 CTCTTTCTCTACTCGGGGAATGG + Intergenic
1123840329 15:24241304-24241326 CTCTGAGTCTAGTCCGTGTAGGG + Intergenic
1125396698 15:39256396-39256418 CTCTTTCCCTCCTCTGTGTGTGG + Intergenic
1127708665 15:61573432-61573454 CTGGGTGTCTACTCTATGTAAGG + Intergenic
1127814871 15:62599049-62599071 CTCCTTGTCACCTCTGTGTCAGG + Intronic
1130950602 15:88584005-88584027 CTCTTTTCCTACTATGTGTGTGG + Intergenic
1130977964 15:88791834-88791856 CTCTTTGTGTGCCCTGTGTCTGG - Intergenic
1132998490 16:2836757-2836779 CTCTTTGTCTTCTCTTTCTCTGG - Intronic
1136739658 16:32505527-32505549 CTTTTTGTCCACTCTGTGAGTGG - Intergenic
1136741481 16:32533758-32533780 GTTTTTGTCTATTCTGTGAATGG - Intergenic
1137282545 16:46990495-46990517 TTCAGTGTCTACTCTGTGTCAGG - Intergenic
1138062095 16:53902533-53902555 CTTTTTCTCTACCCTGTGTTTGG + Intronic
1139083883 16:63561035-63561057 CCCTGTGGGTACTCTGTGTAGGG + Intergenic
1140838952 16:78821162-78821184 CTATTTGCCTTCTCTGTGTTGGG + Intronic
1140943178 16:79741996-79742018 CTCTTTTTCTATTTTTTGTAAGG - Intergenic
1203012175 16_KI270728v1_random:305467-305489 GTTTTTGTCCACTCTGTGAATGG + Intergenic
1203013258 16_KI270728v1_random:321810-321832 CTTTTTGTCCACTCTGTGAGTGG + Intergenic
1203013372 16_KI270728v1_random:323440-323462 CTTTTTGTCCATTCTGTGAATGG + Intergenic
1203028122 16_KI270728v1_random:541476-541498 GTTTTTGTCTATTCTGTGAATGG + Intergenic
1203029589 16_KI270728v1_random:563910-563932 CTTTTTGTCCATTCTGTGAATGG + Intergenic
1203030510 16_KI270728v1_random:578626-578648 GTTTTTGTCCACTCTGTGAATGG + Intergenic
1203031593 16_KI270728v1_random:594969-594991 CTTTTTGTCCACTCTGTGAGTGG + Intergenic
1203031707 16_KI270728v1_random:596599-596621 CTTTTTGTCCATTCTGTGAATGG + Intergenic
1203040014 16_KI270728v1_random:737832-737854 CTTTTTGTCCATTCTGTGAATGG - Intergenic
1203040128 16_KI270728v1_random:739462-739484 CTTTTTGTCCACTCTGTGAGTGG - Intergenic
1203041211 16_KI270728v1_random:755805-755827 GTTTTTGTCCACTCTGTGAATGG - Intergenic
1203042132 16_KI270728v1_random:770521-770543 CTTTTTGTCCATTCTGTGAATGG - Intergenic
1203043599 16_KI270728v1_random:792955-792977 GTTTTTGTCTATTCTGTGAATGG - Intergenic
1142883233 17:2896954-2896976 CTCTCTGTCTGCTCTATGCAGGG + Intronic
1143516886 17:7424041-7424063 CTCTGCATCTACTCTGTGTTTGG + Intergenic
1143831914 17:9659278-9659300 TTTATTGTCTACTCTGTGTCAGG - Intronic
1143937629 17:10503649-10503671 CCCTTTGTCTACTCTGTCACTGG - Intronic
1145418389 17:22743009-22743031 CTTTTTGTATATTCTGTGCAGGG + Intergenic
1146781642 17:35679436-35679458 ATCTTGGTCTACTCTGGGAATGG + Intronic
1147027325 17:37598567-37598589 CTCTTTCTCTCCTCTGTCTCCGG + Intronic
1153379612 18:4423418-4423440 CTCTTTGCCTACTAAGTGCACGG + Intronic
1153802801 18:8685884-8685906 ATCTTTGTGTTCTCTGTGTTTGG + Intergenic
1158774279 18:60557159-60557181 ATCTTTGTCTACTGTGTGTCTGG - Intergenic
1159949489 18:74471925-74471947 CTTTTTTTCCCCTCTGTGTATGG + Intergenic
1160706532 19:532544-532566 CTCTTTGTCTCCTCCGGGGAGGG - Intronic
1161251232 19:3281393-3281415 GTCTCTGTCTACTCTCTGTCGGG + Intronic
1168331482 19:55572423-55572445 CTCTTTGTCAATTCTGTATTTGG + Intergenic
927104107 2:19809441-19809463 GACTTCGTCTACTCTGTGCATGG - Intergenic
927560978 2:24073100-24073122 CTCTTGGTTTACTCTCTGGAGGG + Intronic
928576701 2:32662961-32662983 TTCTTTGTTTACACTGTGTGGGG + Intronic
929907254 2:46057072-46057094 CTCTATGTGGTCTCTGTGTATGG + Intronic
930347021 2:50196226-50196248 CTCTCTTACTAATCTGTGTAGGG + Intronic
932834058 2:75018824-75018846 TTCTTAGTCTGCTCTGTGCATGG + Intergenic
933457883 2:82540240-82540262 ATCTTTGTCTACTCTGTAATTGG - Intergenic
935762185 2:106331421-106331443 ATCTGTGTCTACTCTGTGCCAGG - Intergenic
938091223 2:128436034-128436056 CTCTTGCTCCACTCTGTGTGTGG - Intergenic
939096452 2:137838280-137838302 CTCTGTGTCTCCTTTGGGTAGGG - Intergenic
939407887 2:141782832-141782854 TTGTATGTTTACTCTGTGTAAGG + Intronic
940661072 2:156545939-156545961 CTCTTATTCTGCTCTGTGCAAGG + Intronic
941351553 2:164443383-164443405 ATTTTTTTCTACTCTTTGTATGG - Intergenic
942826870 2:180188908-180188930 CTCTGTGTCTCATCTGTGAAAGG - Intergenic
943923632 2:193742432-193742454 TTCTTTGTCATCTCTGTGTGTGG - Intergenic
944639548 2:201709540-201709562 AACTTTGTCTACTCTGTGGTTGG + Intronic
1169014716 20:2282255-2282277 CTCTGTGTCTTCTCTGTGCTAGG + Intergenic
1170962776 20:21040040-21040062 CTCTTTCTCTCCTCTGTGTGAGG + Intergenic
1172194011 20:33079715-33079737 CACCTTGTCTACTCAGTGTCCGG + Intronic
1174167602 20:48596231-48596253 TTCTTTCTCTACTCTGTCTGGGG - Intergenic
1177300965 21:19245197-19245219 CTCTCTGTCTTCTCTTTGTCTGG + Intergenic
1179016992 21:37602492-37602514 CTCATTGTCTACTTTGCCTAGGG - Intergenic
1179163830 21:38919662-38919684 CTCTTTGGCTGCTGTGTGTTTGG - Intergenic
1182713221 22:32335437-32335459 GTCTCTGTCCACTCTGTGTGTGG - Intergenic
949145097 3:690659-690681 ATCTCTGTCTACTCTCTGGAAGG - Intergenic
950224654 3:11223868-11223890 ATCTTTGTTTACTGTGTGTTTGG - Intronic
955329358 3:58034191-58034213 ATCTTTTACTACTCTTTGTATGG + Intronic
957403812 3:79750770-79750792 CTCTTTTTCTTCTCAGTCTAGGG + Intronic
958837190 3:99159134-99159156 CTCAGTGACGACTCTGTGTAGGG + Intergenic
959257525 3:104033476-104033498 CTCTGTGTCTTTTATGTGTAGGG - Intergenic
959692351 3:109211462-109211484 CTGTTTTTCTACTCTGAATATGG + Intergenic
961122279 3:124383036-124383058 CTCTTTTTCAACCCTGTGTTGGG + Intronic
961334466 3:126162591-126162613 CTCTTTGTCAGATATGTGTATGG + Intronic
962201430 3:133403823-133403845 GTCTTTGTCTCCTCTGGGTGGGG - Intronic
962796664 3:138855560-138855582 CTCTTTCTTACCTCTGTGTATGG - Intergenic
963240027 3:142993775-142993797 TTTTTTGTCTACTCTGTGGTAGG + Intronic
963853073 3:150226843-150226865 CTCATTCCCTTCTCTGTGTAGGG + Intergenic
965810893 3:172591100-172591122 TTCTTTCTCATCTCTGTGTATGG + Intergenic
966127547 3:176597172-176597194 TTCTTAGTCTACTCAGTGTGAGG + Intergenic
966903042 3:184500745-184500767 CTCTTTGTTTCCTCTCTGCAGGG - Intronic
970808451 4:20063271-20063293 CTCTTTGTCTGGTCTTTGTTGGG - Intergenic
971974639 4:33668045-33668067 CTCTTTCTCTACTCTTTATAAGG + Intergenic
972170425 4:36339129-36339151 CTCTTTTGGTACTCTGTGGACGG - Exonic
972869646 4:43281498-43281520 TTCTTTTTCTTCTCTGAGTAAGG + Intergenic
974880872 4:67756142-67756164 CTCTTTGTCTTCTATATCTAGGG + Intergenic
975235404 4:71989692-71989714 CTCTTGGACTTCTCTGTGGAAGG + Intergenic
976954559 4:90879802-90879824 TTCTTTCTCATCTCTGTGTATGG + Intronic
977839012 4:101678389-101678411 CTCTGAGTCTACTCTGTGTCCGG + Intronic
978069622 4:104451336-104451358 ATCCTTGTGTAGTCTGTGTAGGG - Intergenic
979174588 4:117647564-117647586 CTCTATGTCTAGTCTGTGTAGGG + Intergenic
979477493 4:121175339-121175361 TTCTTTTTCTTCTCTTTGTAGGG + Intronic
980418605 4:132527382-132527404 ATTTTTGTCTACTCTCTGCAAGG + Intergenic
980741238 4:136952202-136952224 TTCATTGTCATCTCTGTGTAGGG + Intergenic
981041548 4:140227504-140227526 CTATTTATTTACTCTGTGTTTGG + Intergenic
982011210 4:151107905-151107927 CTCTTTTTCTACCCTGGGGAGGG - Intronic
983858093 4:172670469-172670491 TTCTTTGTCCACTCTTTTTATGG + Intronic
984141301 4:176006475-176006497 CTGTTTGTCTGCACTGTATATGG - Intergenic
986855952 5:11868947-11868969 GTCTTTGTCTTGTCTGTGTTCGG - Intronic
987344343 5:16965709-16965731 CTTTTTGTTTTCTCTGTCTAGGG - Intergenic
988165609 5:27585584-27585606 TTCTTTGTTTACTCTGTTGATGG + Intergenic
989708724 5:44370557-44370579 CTCTTTGTCTACTGAGTGCTGGG - Intronic
989830362 5:45909675-45909697 GTTTTTGTCCACTCTGTGAATGG + Intergenic
989830876 5:45916823-45916845 GTTTTTGTCCACTCTGTGAATGG - Intergenic
989830896 5:45917167-45917189 GTTTTTGTCTATTCTGTGAATGG - Intergenic
989851365 5:46215867-46215889 CTTTTTGTCCATTCTGTGAATGG + Intergenic
990411696 5:55547520-55547542 CTATTTGTCTACTCCATGTTAGG - Intergenic
991389376 5:66125848-66125870 CTCTCTCTCTACTCTGAGGATGG + Intergenic
991508333 5:67349751-67349773 CTCTTGGTCTAGTGTGTGTAAGG - Intergenic
991557496 5:67912002-67912024 CTCTTTTTTCACTCTGTGTGTGG - Intergenic
991962082 5:72055188-72055210 CTAGTTGTCTAATCTGAGTATGG + Intergenic
992155037 5:73946607-73946629 CTAGTTGTCTACTCTTTGAATGG + Intergenic
992332496 5:75731557-75731579 CTCTTAGTGCACTCTGTGTGTGG - Intergenic
992723324 5:79581790-79581812 CTGAGTGTCTACTCTGTGTTAGG + Intergenic
992997027 5:82344180-82344202 CACTTTTTCTACTGTGGGTAGGG + Intronic
993337230 5:86675542-86675564 CACTTTGTCTACTGTTTGTGTGG + Intergenic
995727379 5:115195515-115195537 CTCTTTTTGTACTGTGTTTAAGG + Intergenic
996461499 5:123749104-123749126 CTCTATGTCCACTCCGTGTTCGG - Intergenic
996662398 5:126019936-126019958 CATTTTGTCTATACTGTGTAGGG + Intergenic
996758509 5:126962004-126962026 CTGTTTGTTTACACTGTGAATGG - Intronic
997665022 5:135623700-135623722 CTGGGTGTCTCCTCTGTGTAAGG - Intergenic
997823505 5:137086472-137086494 CTCTTTGTTTACTCTGAGTGTGG + Intronic
998071859 5:139204007-139204029 GTCTGTGTCTGCCCTGTGTATGG - Intronic
1000712924 5:164602589-164602611 ATCATTGTCCACTCTGTGCATGG + Intergenic
1000858058 5:166424469-166424491 CTCATTGCCTACTATGTGTCAGG + Intergenic
1001242812 5:170082973-170082995 CTCTCTGTCTCCTCTAAGTAAGG - Exonic
1006223863 6:32519573-32519595 CTCCTGGTCTGCTCTGTGAATGG - Exonic
1008565013 6:52759179-52759201 TTATTTGTATACTGTGTGTATGG + Intronic
1009259869 6:61472084-61472106 CTTTTTGTCTTTTCTGTGGATGG + Intergenic
1009260135 6:61475868-61475890 GTTTTTGTCTATTCTGTGAATGG + Intergenic
1009260264 6:61477419-61477441 CTTTTTGTCCATTCTGTGAATGG + Intergenic
1009260615 6:61481603-61481625 CTTTTTGTCCACTCTGTGAATGG - Intergenic
1009261542 6:61496555-61496577 CTTTTTGTCCATTCTGTGAATGG - Intergenic
1009262332 6:61508928-61508950 CTTTTTGTCAATTCTGTGAATGG - Intergenic
1009688921 6:67001047-67001069 GTCTTTGTCTAATTTGGGTATGG - Intergenic
1009713676 6:67358863-67358885 CTCCGTGTCTTCTCTATGTAAGG + Intergenic
1012438330 6:99238393-99238415 TTCTTTGTCTACACTGTGCCAGG + Intergenic
1013201199 6:107897874-107897896 CTGATTGACTACTCTGTATAAGG + Intronic
1013871949 6:114774788-114774810 CTCTTAGGCTACTCTGTTTTAGG - Intergenic
1014580507 6:123131077-123131099 CTCATTGCCTACTCTGTGCTGGG - Intergenic
1015494262 6:133864552-133864574 TTCTTTGTCATCTCTGTGTGTGG + Intergenic
1015875195 6:137815808-137815830 CTCTCTGTCAACTCTGTGCACGG + Intergenic
1016375472 6:143416385-143416407 GTCTTTGTCTACTCTGTGTTGGG - Intergenic
1018357075 6:163029045-163029067 CTCCTTGCCTCCTCTTTGTAAGG - Intronic
1019026608 6:168970829-168970851 CTCTTTCTCTCTACTGTGTAAGG - Intergenic
1020169116 7:5831495-5831517 CTCTTTGTCTTCTCAGTCCAGGG + Intergenic
1021031337 7:15740144-15740166 TTCTGTGTCTTCTCTGTTTATGG - Intergenic
1021571384 7:22068680-22068702 CTCTTTGAATACTCTTTGTAAGG + Intergenic
1022744418 7:33155681-33155703 CTTTGTGTCTACTCTGTCTCAGG + Exonic
1024009974 7:45259160-45259182 CCTTGTGTCTCCTCTGTGTAGGG + Intergenic
1025528521 7:61845808-61845830 CTTTTTGTCCATTCTGTGAATGG - Intergenic
1025529909 7:61866797-61866819 CTTTTTGTCCATTCTGTGAATGG - Intergenic
1025530743 7:61879427-61879449 CTTTTTGTCTATTCTGCGAATGG - Intergenic
1025531315 7:61888347-61888369 GTTTTTGTCTATTCTGTGAATGG - Intergenic
1025581085 7:62718734-62718756 GTTTTTGTCTATTCTGTGAATGG + Intergenic
1025581693 7:62727711-62727733 GTTTTTCTCCACTCTGTGTATGG + Intergenic
1025583336 7:62748110-62748132 ATTTTTGTCTATTCTGTGAATGG + Intergenic
1025587045 7:62803491-62803513 GTTTTTGTCCACTCTGTGAATGG - Intergenic
1025589180 7:62834045-62834067 CTTTTTGTCCATTCTGTGAATGG + Intergenic
1025592694 7:62882663-62882685 CTTTTTGTCCATTCTGTGAATGG + Intergenic
1025595715 7:62922778-62922800 TTTTTTGTCCATTCTGTGTATGG + Intergenic
1025596197 7:62929850-62929872 CTTTTTGTCCATTCTGTGAATGG - Intergenic
1025598237 7:62959496-62959518 CTTTTTGTCCATTCTGTGAATGG + Intergenic
1027986843 7:85303685-85303707 CTCTCTGACTAATCTTTGTAAGG - Intergenic
1028627951 7:92898499-92898521 AGCTTTGTCTACACTGTGTGGGG + Intergenic
1028706377 7:93852246-93852268 ATTTTTGTCTCCTCTGTGGAGGG - Intronic
1028758645 7:94468097-94468119 CTATTTTACTACTCTGTATACGG - Intergenic
1030771099 7:113475694-113475716 CACTTTGTTTACACTGTGAAGGG + Intergenic
1031262350 7:119537060-119537082 CTCTTTGTCTAATCTATTTTAGG - Intergenic
1032158072 7:129486476-129486498 TTCCTTGTGTACTCTGTATAGGG + Exonic
1033445365 7:141416820-141416842 CTCGTTATGTACTCTGTGTCTGG - Intronic
1033663199 7:143417839-143417861 CTCTCTGCCTCCTATGTGTAAGG + Intergenic
1034384887 7:150732756-150732778 CTCTTTGTCTCCCCTCTGAAGGG + Intronic
1035924442 8:3711884-3711906 CTGTTTGTCTTATCTGTTTAGGG - Intronic
1037290404 8:17343873-17343895 CTCTTTGGATAATCTGTCTAGGG - Intronic
1040112732 8:43577094-43577116 CTCTTTGTAGAATCTGTGAAAGG + Intergenic
1040112996 8:43580539-43580561 CTTTTTGTAGACTCTGTGAAGGG + Intergenic
1040113868 8:43591899-43591921 CTCCTTGTAGACTCTGTGAATGG + Intergenic
1040118419 8:43652008-43652030 CTCTTTGTAGAATCTGTGAAGGG + Intergenic
1040281663 8:46054732-46054754 CTCTTTGTACAATCTGTGAAGGG + Intergenic
1040296983 8:46155953-46155975 CTCTTTGTGCAATCTGTGAATGG - Intergenic
1040320906 8:46300511-46300533 CTTTTTGTCGAATCTGTGAAGGG - Intergenic
1040322271 8:46321332-46321354 CTTTTTGTAGAATCTGTGTAGGG - Intergenic
1040326685 8:46348283-46348305 CTTTTTGTATAATCTGTGAATGG + Intergenic
1040327538 8:46360784-46360806 CTGTTTGTACACTCTGTGAAGGG - Intergenic
1040344070 8:46469578-46469600 CTCTTTGTAGAATCTGTGAAGGG - Intergenic
1047896650 8:129373776-129373798 CTCTTTCTCTCATCTGTGGAAGG + Intergenic
1049026816 8:139997283-139997305 TGCATTGTCTTCTCTGTGTAGGG - Intronic
1049060167 8:140270521-140270543 CTCTTTCTCTAATCAGGGTATGG - Intronic
1051673052 9:19531645-19531667 CTCAGCATCTACTCTGTGTAAGG + Intronic
1051730867 9:20141307-20141329 ATTTCTCTCTACTCTGTGTAGGG + Intergenic
1051922500 9:22284433-22284455 TTGTTTGCCTACTCTGTGTAAGG - Intergenic
1053308650 9:37001712-37001734 CCCTTTCTCAGCTCTGTGTAAGG - Intronic
1054363277 9:64200976-64200998 CTTTTTGTCTTTTCTGTGGATGG + Intergenic
1054363467 9:64203659-64203681 CTTTTTGTCCACTCTGTGAATGG - Intergenic
1055191705 9:73532213-73532235 CTCTTTTTCTCCTGTGTGGAAGG + Intergenic
1055674421 9:78640873-78640895 CACTTTGTCAACACTGTGCAGGG - Intergenic
1055820504 9:80256186-80256208 TGATTTGTATACTCTGTGTAGGG + Intergenic
1056481922 9:87014474-87014496 CTTTTTGTTTTCTCTGTGTCAGG + Intergenic
1056801957 9:89698591-89698613 CTCCTTCTCTCCTCTGTGTCCGG + Intergenic
1057813471 9:98275958-98275980 CTCTTTTTCTAATCTCTGAAAGG - Intergenic
1060149598 9:121279786-121279808 CACTCTGTCAACTCTGTGTGAGG - Intronic
1185521907 X:746729-746751 CTCTCTGTCTCCACTGTGTGAGG + Intergenic
1185593443 X:1293539-1293561 CTCTTTGTCTACTCTGTGTAGGG - Intronic
1186461229 X:9750151-9750173 CTGTTTGTCTACTGTGAGTAGGG + Intronic
1191239580 X:58173411-58173433 CTCTTTGTAGAATCTGTGAAGGG + Intergenic
1191264395 X:58369944-58369966 GTCTTTGTATAATCTGTGAAGGG - Intergenic
1191265442 X:58386336-58386358 GTCTTTGTCCATTCTGTGAATGG - Intergenic
1191267196 X:58409618-58409640 GTTTTTGTCTATTCTGTGAATGG - Intergenic
1191268281 X:58426665-58426687 GTTTTTGTCTATTCTGTGAATGG - Intergenic
1191954699 X:66631717-66631739 CTGTTTGTCTTCACTTTGTAAGG - Intronic
1192210111 X:69122432-69122454 CTCTGTGTCTTCTCTGTGCTTGG - Intergenic
1192696522 X:73421955-73421977 TTCTTTGTCATCTCTGTGTGTGG + Intergenic
1193344697 X:80391902-80391924 GTCTTTGTTTACTCTAAGTATGG + Intronic
1194054420 X:89114130-89114152 ATCTTTGTCAACTATTTGTAAGG - Intergenic
1194277293 X:91900970-91900992 CTGTGTGTCTACTCTGTGTCAGG + Intronic
1194346713 X:92773952-92773974 CCCATTGTCTACTGTGTGAATGG - Intergenic
1195148956 X:102045496-102045518 TTCTTTCTCATCTCTGTGTATGG - Intergenic
1197786159 X:130199385-130199407 CTCTTTTTCTACCCTGTGGCAGG + Intergenic
1199381944 X:147181674-147181696 CTCTCTCTCTTCCCTGTGTAAGG - Intergenic
1200427126 Y:3033782-3033804 CTCTCTGTCTCCTCTTTTTAAGG + Intergenic
1200594635 Y:5123067-5123089 TTGTGTGTCTACTCTGTGTCAGG + Intronic
1200655046 Y:5890596-5890618 CCCATTGTCTACTGTGTGAATGG - Intergenic