ID: 1185596296

View in Genome Browser
Species Human (GRCh38)
Location X:1308876-1308898
Sequence CCTCATAGTTGACGATGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 31}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185596296_1185596304 26 Left 1185596296 X:1308876-1308898 CCTGTTCATCGTCAACTATGAGG 0: 1
1: 0
2: 0
3: 1
4: 31
Right 1185596304 X:1308925-1308947 TTTACCCCAGGAAAAACCCATGG 0: 1
1: 0
2: 0
3: 18
4: 185
1185596296_1185596303 14 Left 1185596296 X:1308876-1308898 CCTGTTCATCGTCAACTATGAGG 0: 1
1: 0
2: 0
3: 1
4: 31
Right 1185596303 X:1308913-1308935 CTGTCTCAGATCTTTACCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185596296 Original CRISPR CCTCATAGTTGACGATGAAC AGG (reversed) Intronic
901768819 1:11520392-11520414 CCTCATAGTTTATGACGAGCTGG - Intronic
903182519 1:21612082-21612104 CGTCAAAGGTGACGATGAGCCGG + Exonic
903968800 1:27106004-27106026 CCCCATAGGCGATGATGAACTGG + Exonic
1064692779 10:17934819-17934841 CCTCCTAATTGACCATCAACAGG - Intergenic
1074932176 10:118139538-118139560 CCACATAGTTGACAAGGAACTGG + Intergenic
1077822687 11:5765254-5765276 CCTCTTTGTTGATGATGATCAGG - Intronic
1081247863 11:40791676-40791698 ACTCATAGATCACGATGAATTGG - Intronic
1092755992 12:11763908-11763930 GCTTATAGTTGACTGTGAACGGG + Intronic
1097329891 12:58321438-58321460 CCTCATAATTGACTAGGAATGGG + Intergenic
1097632006 12:62075535-62075557 CCTTATAGTTGTCTAGGAACAGG - Intronic
1103860180 12:124006162-124006184 CCACAAAGTGGACTATGAACTGG - Intronic
1111112393 13:83730782-83730804 GCTCATAGTTTGGGATGAACTGG + Intergenic
1114351005 14:21851110-21851132 TCTCATAGTTGAAGAGGAATAGG - Intergenic
1129009658 15:72403980-72404002 CCTCATGGTAGAAGAGGAACTGG + Intronic
1134200795 16:12197012-12197034 CCACAGAGTTGGAGATGAACAGG + Intronic
1143136733 17:4716488-4716510 CCTGGTAGGTGGCGATGAACAGG - Exonic
1149202031 17:54197641-54197663 CCCCTTAGTTGACAATGAATGGG + Intergenic
1162191884 19:8953529-8953551 GCTCAAACTTGAAGATGAACTGG + Exonic
932775847 2:74527974-74527996 TCCCCTAGTTGGCGATGAACAGG + Exonic
941464089 2:165804905-165804927 CCTCACAGACCACGATGAACTGG + Intergenic
1184365294 22:44047242-44047264 CCTCATAGTGGAAGGTGAAGAGG + Intronic
1185202993 22:49519781-49519803 ACTCGTAGTGGAAGATGAACCGG + Intronic
949121781 3:393300-393322 CCTTATATTAGTCGATGAACTGG + Intronic
970530021 4:16971979-16972001 CTTCATAGTTGGCGATAAATGGG + Intergenic
974900363 4:67988995-67989017 ACTCATAGTTGAGGCTGAAATGG - Intergenic
983850422 4:172573241-172573263 CTTCATTGTTGACAATGTACTGG + Intronic
988046114 5:25956202-25956224 CCTCATAATTGCCCATGAAAAGG + Intergenic
990618847 5:57538376-57538398 CCTGATGGTTGGAGATGAACTGG - Intergenic
999341896 5:150779726-150779748 CCTCAGAGATGACGATAGACAGG - Intronic
1053519603 9:38764397-38764419 CATCATGGTGGAAGATGAACAGG - Intergenic
1185596296 X:1308876-1308898 CCTCATAGTTGACGATGAACAGG - Intronic
1190213471 X:48466058-48466080 GCTCAGATTTGATGATGAACAGG + Exonic
1197666850 X:129233523-129233545 CATCATAGTTGAAGAAGAATGGG - Intergenic