ID: 1185596303

View in Genome Browser
Species Human (GRCh38)
Location X:1308913-1308935
Sequence CTGTCTCAGATCTTTACCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 134}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185596294_1185596303 18 Left 1185596294 X:1308872-1308894 CCACCCTGTTCATCGTCAACTAT 0: 1
1: 0
2: 0
3: 4
4: 69
Right 1185596303 X:1308913-1308935 CTGTCTCAGATCTTTACCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 134
1185596295_1185596303 15 Left 1185596295 X:1308875-1308897 CCCTGTTCATCGTCAACTATGAG 0: 1
1: 0
2: 0
3: 3
4: 75
Right 1185596303 X:1308913-1308935 CTGTCTCAGATCTTTACCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 134
1185596301_1185596303 -10 Left 1185596301 X:1308900-1308922 CCCATGGGTGGATCTGTCTCAGA 0: 1
1: 0
2: 1
3: 9
4: 114
Right 1185596303 X:1308913-1308935 CTGTCTCAGATCTTTACCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 134
1185596296_1185596303 14 Left 1185596296 X:1308876-1308898 CCTGTTCATCGTCAACTATGAGG 0: 1
1: 0
2: 0
3: 1
4: 31
Right 1185596303 X:1308913-1308935 CTGTCTCAGATCTTTACCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 134
1185596293_1185596303 25 Left 1185596293 X:1308865-1308887 CCAAAGACCACCCTGTTCATCGT 0: 1
1: 0
2: 0
3: 4
4: 105
Right 1185596303 X:1308913-1308935 CTGTCTCAGATCTTTACCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185596303 Original CRISPR CTGTCTCAGATCTTTACCCC AGG Intronic
900248029 1:1648395-1648417 CGGTCTCGGACCTTGACCCCTGG + Intronic
900259253 1:1715546-1715568 CGGTCTCGGACCTTGACCCCTGG + Intronic
900716312 1:4147298-4147320 CTGTCTCTGATTTCTACCCTGGG + Intergenic
904048982 1:27626690-27626712 CTGCCTGAGACCTTTGCCCCGGG + Intronic
905533866 1:38703147-38703169 TTGCCTCAGTTCTTTACCTCTGG + Intergenic
910262551 1:85306265-85306287 CTGTCTCTGATCCTGACCACAGG + Intergenic
911437779 1:97884397-97884419 CTCTCCCAGATCTTTTCTCCAGG - Intronic
912489406 1:110053656-110053678 TTGTCTCAGATCTTGATGCCCGG + Exonic
914407383 1:147389622-147389644 CTCCCTCAGATGTTTGCCCCAGG - Intergenic
914741692 1:150471205-150471227 CTTTCTAAGATCATTAGCCCTGG + Exonic
916116095 1:161486296-161486318 CTGCCTCAGATGGTTCCCCCAGG + Intergenic
916366030 1:164028709-164028731 GTGTATCAGCTCTCTACCCCTGG - Intergenic
916405785 1:164496808-164496830 CTGTCTCATAGCTTTGCCCTCGG - Intergenic
918393572 1:184091620-184091642 TTTTCTAAAATCTTTACCCCAGG - Intergenic
920798012 1:209159295-209159317 CTGTCTTAGATTTTTAGCTCTGG - Intergenic
922008831 1:221560192-221560214 ATGTCTCTTATCTTTATCCCTGG - Intergenic
924622475 1:245673795-245673817 TTCTCTCAGATCTTTCCTCCCGG - Intronic
1065521472 10:26577740-26577762 AAGTCTGAGATCTTTAGCCCAGG + Intergenic
1065527293 10:26635993-26636015 AAGTCTGAGATCTTTAGCCCAGG + Intergenic
1065530408 10:26664285-26664307 AAGTCTGAGATCTTTAGCCCAGG + Intergenic
1069046706 10:63750903-63750925 CTGTCTCAGATTTGGTCCCCTGG + Intergenic
1069223854 10:65916672-65916694 CTGTCTCTCATCTCTATCCCAGG - Exonic
1070540862 10:77414230-77414252 CTGTCTCAGCTCTGTAACCCTGG + Intronic
1073176031 10:101558347-101558369 CTGTGTCAGATCTCTTCCCCAGG + Intergenic
1075420877 10:122299363-122299385 CTGTCTCAGGTATTTTCACCTGG + Intronic
1081276419 11:41155109-41155131 CTGTCTCTGAGCTTTACCTCTGG + Intronic
1081709289 11:45206582-45206604 CCATCTCTGATCTTTCCCCCTGG + Intronic
1083103545 11:60335187-60335209 CTGTCCCAGAACTTTTCCACAGG + Intronic
1088106968 11:106218305-106218327 CTGTCTCAGAACGTTCCCCAAGG + Intergenic
1088621853 11:111693030-111693052 CTGTCTCAAGTTTTTACCCACGG - Intronic
1089104754 11:115993170-115993192 CTGTCTCAGTTCTTTTCCAATGG - Intergenic
1089559562 11:119337005-119337027 CAGTCTCAGGAGTTTACCCCTGG + Exonic
1090225736 11:125071176-125071198 CTGGCTCAGGTCTTGTCCCCTGG + Intronic
1093573128 12:20692339-20692361 CTATCTTATATCTTTACACCTGG + Intergenic
1096862039 12:54536293-54536315 CTGTCTCCTCTCTCTACCCCAGG - Intronic
1098239396 12:68451316-68451338 CTTACTCAGATCTTTACAACAGG - Intergenic
1099165592 12:79303231-79303253 TTGTCTCAGTTCTGCACCCCAGG + Intronic
1100735009 12:97518686-97518708 CTGTCTCTGTTCTTTCCTCCTGG + Intergenic
1101997208 12:109533852-109533874 CTGCCTCAGATCTGGAGCCCTGG - Intronic
1103248820 12:119482288-119482310 CTAAGTCAGATCTTTACACCAGG + Intronic
1104247732 12:127059713-127059735 CTGTCTCAAACATTTTCCCCAGG + Intergenic
1104318412 12:127725892-127725914 ATGTTTCAGTTCTTCACCCCTGG + Intergenic
1107609556 13:42099487-42099509 CTCTCTCAGGTCTTCTCCCCAGG - Intronic
1112281172 13:98064321-98064343 CTGCCACAGATGTTTGCCCCTGG + Intergenic
1120818567 14:88890444-88890466 CTGTATCAGATATTTCCCACTGG - Intergenic
1126297176 15:47153057-47153079 CTGTCTCTAATCTCTGCCCCTGG + Intergenic
1128680366 15:69647182-69647204 CTGTCTTGGATCTTGACCCCTGG + Intergenic
1129835539 15:78703124-78703146 ATGTCTCAGAGCCTTACTCCAGG + Intronic
1130033956 15:80341268-80341290 CTGTCTCAGGTGTTTAAGCCTGG - Intergenic
1132954200 16:2582545-2582567 CTGTCTCACCTCTTTCCCCTGGG - Intronic
1132960145 16:2617618-2617640 CTGTCTCACCTCTTTCCCCTGGG + Intergenic
1134403214 16:13931404-13931426 CTGTATTAAATCTTGACCCCAGG - Intronic
1134413892 16:14027363-14027385 CTGTCTCCAATCCTAACCCCTGG - Intergenic
1135006953 16:18834131-18834153 CTTTCTCATCTCTTTAACCCAGG - Intronic
1138073519 16:54017788-54017810 CTGCCTCAAGTCTTTTCCCCAGG + Intronic
1138191390 16:55016858-55016880 CAGACTCAGATCTGTGCCCCTGG + Intergenic
1138232743 16:55351078-55351100 TTGCCTCAAAACTTTACCCCTGG - Intergenic
1139205441 16:65024158-65024180 CTTTCTCAGTACTTTACCCCTGG + Intronic
1145973526 17:28970941-28970963 CTTTCTCCGATCCTTTCCCCTGG + Intronic
1147158477 17:38557485-38557507 CTGTCTCAGATCCTTATCACTGG + Intronic
1147499978 17:40953685-40953707 CTGTCTGAGATGTTTTCTCCAGG + Intergenic
1147608632 17:41788236-41788258 TTCTCTCTGATCTCTACCCCAGG - Intergenic
1150648814 17:66996748-66996770 CAGTCTCAGATCCAGACCCCTGG + Intronic
1152406786 17:80102309-80102331 CTGTCTCTGGTCTTTGTCCCTGG + Intergenic
1153500879 18:5748595-5748617 CTGTCCTAGATCTGTCCCCCAGG - Intergenic
1153779061 18:8478427-8478449 CCGTCTCAGATCTTGTCACCCGG - Intergenic
1155032469 18:21996647-21996669 CTGACTCAGACCTTTCACCCAGG + Intergenic
1157763039 18:50278377-50278399 CTGTCTTTGATCTGTAACCCAGG + Intronic
1165981918 19:39731659-39731681 CTGTCTCAGATAGTTACAACAGG - Intronic
1167910884 19:52700816-52700838 CTGTCTCAGGTCGTTGTCCCTGG - Intergenic
926108424 2:10166863-10166885 CTCTCTCAGAGCTTTTACCCTGG + Intronic
939121912 2:138127353-138127375 CTGTCCCAGCTCTTTAGACCAGG + Intergenic
945178260 2:207065227-207065249 CTGTGTCAGATCTTTCCAACAGG - Intergenic
1170101753 20:12708765-12708787 CTTTCTTAGATCTTCATCCCAGG + Intergenic
1171299907 20:24051035-24051057 CTGTGTCAAATTTTTTCCCCAGG - Intergenic
1173347587 20:42215174-42215196 CTGTCTGAGCTCTGAACCCCTGG + Intronic
1176265061 20:64204956-64204978 CTGTCGCAGACCTTCACCCTGGG - Intronic
1177944846 21:27455372-27455394 CTTTCTCAGATGTTTAACCATGG - Intergenic
1178588499 21:33889404-33889426 GTGTCTTAGGTCTTTGCCCCGGG - Exonic
1183276436 22:36900975-36900997 CTGGCTCAGATCTATCCCCTGGG + Intergenic
1183395217 22:37567588-37567610 CTGTCTCAGGTCTGTAGTCCTGG + Intronic
950395126 3:12728248-12728270 GTGTCTCAGCTCTTTATCTCAGG + Intergenic
952749349 3:36812780-36812802 CTGTATCTGATTTTTTCCCCAGG - Intergenic
953968078 3:47325556-47325578 CTGTCACATATCTTTTCCACTGG - Intronic
956401652 3:68886042-68886064 TTTTCTCTGATCTTTACCACTGG - Intronic
957302941 3:78416526-78416548 CTGTCTCCAATTTTTATCCCTGG - Intergenic
958843227 3:99233909-99233931 CTGTTTCAGATCTTAGCCCAGGG + Intergenic
960387592 3:117038594-117038616 CTGTCTGAACTCTTTACCCACGG + Intronic
962651224 3:137494717-137494739 CTGCCTCAGAACTTTGCCCTGGG + Intergenic
963356231 3:144211870-144211892 CTGTCTCTGACCTTTCCACCTGG - Intergenic
966099539 3:176249897-176249919 CTGGCTCAGATGTTTATCCTCGG - Intergenic
966733675 3:183171219-183171241 CTGTATCAGTTGTTTACCCTTGG - Intergenic
967118165 3:186360804-186360826 CTGTCTCTCATCATGACCCCTGG + Intronic
967947641 3:194816775-194816797 CCCACTCAGACCTTTACCCCAGG - Intergenic
969258793 4:6021090-6021112 CAGGCTCAGATCTCCACCCCAGG - Intergenic
972782518 4:42298282-42298304 CTGTCACAGAGCTTTACATCTGG - Intergenic
972983784 4:44739140-44739162 CTGTCTCAGATTATTACCATGGG + Intergenic
973956305 4:56066769-56066791 CTGTCTCAGTTCTATGCCCATGG + Intergenic
975861777 4:78685356-78685378 CTTTCTCAGTTCCTTACCCCTGG - Intergenic
976577341 4:86689461-86689483 CTTTCTTAGATCTTTTCCCAAGG + Intronic
977700120 4:100012366-100012388 CTGTCTGAGATCCTTATTCCTGG + Intergenic
983359207 4:166706684-166706706 CTTTCTCCTATCTTTACCCAAGG + Intergenic
984827112 4:183935514-183935536 CTGCCTCTGATCTTCAGCCCTGG - Intronic
986756089 5:10838052-10838074 CTCTCTCAGATGTTTACCCTTGG + Intergenic
988906265 5:35793525-35793547 CTTTTTCAGATCTTTTCCCTGGG - Intronic
990013654 5:51030931-51030953 TTGTCTGAGTTCTTTATCCCTGG - Intergenic
993335551 5:86653797-86653819 CTGACACAGATGTTTTCCCCTGG - Intergenic
993843569 5:92910921-92910943 ATGTCTCTCATCTTTACCCCAGG - Intergenic
995537063 5:113147286-113147308 CTGACTCAGGGCTTTATCCCTGG - Intronic
995962421 5:117858601-117858623 ATGTCTCAGATACTGACCCCAGG - Intergenic
998058142 5:139096827-139096849 CTGTCTCAGAGGCTTACCCAAGG - Intronic
1006575870 6:35045273-35045295 TTGTCTCAGATCTTTACAGCAGG + Intronic
1006823111 6:36914275-36914297 CTCTCTCAGACTTTGACCCCTGG + Exonic
1009858736 6:69297041-69297063 CTTTCTCAGACTTTTACTCCAGG + Intronic
1012247595 6:96943209-96943231 CTATCACAGTCCTTTACCCCAGG - Intronic
1014349343 6:120320095-120320117 CTGTTTCAGATCTTTCTCCTCGG - Intergenic
1018049703 6:159998006-159998028 CTTTCTCAGATCTCAATCCCAGG - Intronic
1018265304 6:162017971-162017993 CTGTTCCAGATCTTTCCCGCAGG - Intronic
1022135358 7:27442568-27442590 ATGTGCCAAATCTTTACCCCTGG + Intergenic
1024180361 7:46886884-46886906 CTCTCTCAGATCCTTTCCTCTGG - Intergenic
1024907274 7:54400636-54400658 CTGTCTAAAAGCTTCACCCCAGG - Intergenic
1029647641 7:101868445-101868467 CTGTCTCAGTCTTTTCCCCCAGG + Intronic
1031633896 7:124078710-124078732 TTGTCTCAGATGTTTACCTCTGG - Intergenic
1037908010 8:22726833-22726855 CTCTCTCAGATCCCTGCCCCAGG - Intronic
1040059852 8:43094421-43094443 CTGTCTCAGCTCTTTGCCTTTGG + Intronic
1045904376 8:107325320-107325342 TTGCCTCTGATCATTACCCCAGG - Intronic
1046723783 8:117652752-117652774 CACACACAGATCTTTACCCCAGG + Intergenic
1047595220 8:126371304-126371326 CTGTCTCAAATCTTCCCCTCGGG + Intergenic
1050790110 9:9457815-9457837 CCCTCTCATAACTTTACCCCAGG + Intronic
1051805335 9:20986476-20986498 CTGTTTCTGATGTTCACCCCAGG - Intronic
1051853418 9:21535589-21535611 CTCCCTCAGTTCTGTACCCCGGG - Intergenic
1051993582 9:23184700-23184722 CTGTCTCTGATCGTTTGCCCTGG + Intergenic
1053109978 9:35451137-35451159 CTGCCTCAGATCTTAATCTCTGG - Intergenic
1059632580 9:116140478-116140500 CTGTCACATTTCTTTCCCCCAGG + Intergenic
1059816146 9:117917990-117918012 CTGACTCAGATGCCTACCCCAGG - Intergenic
1062481405 9:136754186-136754208 CTGTCTCTGGTCTATACCCTGGG + Intergenic
1185596303 X:1308913-1308935 CTGTCTCAGATCTTTACCCCAGG + Intronic
1188908814 X:35820742-35820764 CAGTCTCAAATCTGTCCCCCTGG + Intergenic
1193560798 X:83013754-83013776 GTGCCTCAGATTGTTACCCCAGG + Intergenic
1194174053 X:90624999-90625021 CTGGCTCAGCACTCTACCCCAGG - Intergenic
1197522481 X:127516774-127516796 CTGTCTTGGATCTTTTCCCTTGG + Intergenic
1197846171 X:130805398-130805420 CTGTCTCAGACATTTTCCCTAGG - Intronic
1199222187 X:145329859-145329881 CTCTCTTAGATCTTTTACCCTGG - Intergenic
1200520274 Y:4202700-4202722 CTGGCTCAGCACTCTACCCCAGG - Intergenic
1201009978 Y:9541226-9541248 CAGGCTCAGATTTTTTCCCCAGG - Intergenic
1202081182 Y:21085695-21085717 CTGTCTGGGATCTTTTCCACAGG + Intergenic