ID: 1185596304

View in Genome Browser
Species Human (GRCh38)
Location X:1308925-1308947
Sequence TTTACCCCAGGAAAAACCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 185}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185596301_1185596304 2 Left 1185596301 X:1308900-1308922 CCCATGGGTGGATCTGTCTCAGA 0: 1
1: 0
2: 1
3: 9
4: 114
Right 1185596304 X:1308925-1308947 TTTACCCCAGGAAAAACCCATGG 0: 1
1: 0
2: 0
3: 18
4: 185
1185596294_1185596304 30 Left 1185596294 X:1308872-1308894 CCACCCTGTTCATCGTCAACTAT 0: 1
1: 0
2: 0
3: 4
4: 69
Right 1185596304 X:1308925-1308947 TTTACCCCAGGAAAAACCCATGG 0: 1
1: 0
2: 0
3: 18
4: 185
1185596295_1185596304 27 Left 1185596295 X:1308875-1308897 CCCTGTTCATCGTCAACTATGAG 0: 1
1: 0
2: 0
3: 3
4: 75
Right 1185596304 X:1308925-1308947 TTTACCCCAGGAAAAACCCATGG 0: 1
1: 0
2: 0
3: 18
4: 185
1185596296_1185596304 26 Left 1185596296 X:1308876-1308898 CCTGTTCATCGTCAACTATGAGG 0: 1
1: 0
2: 0
3: 1
4: 31
Right 1185596304 X:1308925-1308947 TTTACCCCAGGAAAAACCCATGG 0: 1
1: 0
2: 0
3: 18
4: 185
1185596302_1185596304 1 Left 1185596302 X:1308901-1308923 CCATGGGTGGATCTGTCTCAGAT 0: 1
1: 0
2: 0
3: 14
4: 124
Right 1185596304 X:1308925-1308947 TTTACCCCAGGAAAAACCCATGG 0: 1
1: 0
2: 0
3: 18
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185596304 Original CRISPR TTTACCCCAGGAAAAACCCA TGG Intronic
900891618 1:5453890-5453912 CCTAACCCAGGAAAAGCCCAGGG + Intergenic
903540685 1:24094616-24094638 TTTACCCCAGCCCTAACCCAGGG + Intronic
903560885 1:24226006-24226028 TATTCCCCAGGAAAAACCACTGG - Intergenic
906865641 1:49416025-49416047 TTGACCCCTGGATAAATCCAAGG - Intronic
908067354 1:60421328-60421350 TTTAGCCCAGGAAAACCCAGAGG + Intergenic
909127411 1:71691296-71691318 TTTACACCATGAAAGTCCCAAGG + Intronic
909444799 1:75737060-75737082 TTTTCCAAAGTAAAAACCCAAGG - Intronic
911042027 1:93598722-93598744 TTTTCCACAGGGAAAACCAAAGG - Intronic
913094839 1:115506708-115506730 CTTCCCCCAGGAGGAACCCAAGG - Intergenic
913467800 1:119160184-119160206 TTTGCCCAAGGAAAAACAGATGG + Intergenic
913970249 1:143409519-143409541 TTTAACCCAGGAATAATCCAAGG - Intergenic
914064624 1:144235116-144235138 TTTAACCCAGGAATAATCCAAGG - Intergenic
914114526 1:144731238-144731260 TTTAACCCAGGAATAATCCAAGG + Intergenic
918160521 1:181894688-181894710 ATTTCACCAGGAAAAACCTAGGG + Intergenic
918547767 1:185705087-185705109 TTTACCCAAGGGATTACCCAAGG - Intergenic
920528158 1:206684031-206684053 TGTATCTCAGGAAAAGCCCAGGG - Intronic
921779554 1:219146326-219146348 TTTATTCCAGGAAAAATGCAAGG - Intergenic
923627479 1:235625929-235625951 TTCAACCCAGGAAAATTCCAAGG + Intronic
923806244 1:237261328-237261350 TTTCCCCCAGTAAAATCCAAAGG + Intronic
1063997332 10:11632284-11632306 TTTACTTCATGAAAAAGCCAGGG - Intergenic
1065737040 10:28763679-28763701 TTTTCCCCAGGATAATCCAAGGG - Intergenic
1065971386 10:30808761-30808783 TTTCCCCCAGGAGAATCCAATGG + Intergenic
1068490902 10:57722520-57722542 TTTACTCCAAGTAATACCCAAGG + Intergenic
1071390902 10:85174574-85174596 TTGACCCCAGGGAAAACCTATGG + Intergenic
1071907819 10:90194105-90194127 TTTTTCCAAGGAAAAACCAAAGG - Intergenic
1072767693 10:98109090-98109112 TCTACCACAGGAAAAGCCCTGGG + Intergenic
1073484007 10:103805238-103805260 TTTAGCAGAGGAGAAACCCAGGG + Intronic
1074209582 10:111317906-111317928 TTTACCGAAGGAAAAACTAAGGG + Intergenic
1074543562 10:114385544-114385566 GTAACCCCAGCAAAAGCCCACGG - Intronic
1076052490 10:127346817-127346839 TTTCCCCCAGGAAAGTCCCCAGG + Intronic
1077209732 11:1363926-1363948 TTTACATCAGCAGAAACCCAGGG - Intergenic
1079292384 11:19199984-19200006 TTTACAAGAGGAAAGACCCAGGG - Intronic
1079770561 11:24453350-24453372 TTTACCCAAACAAAAGCCCAGGG - Intergenic
1080629082 11:34055912-34055934 TTTGCCCTTTGAAAAACCCAGGG + Intronic
1081398193 11:42612093-42612115 GGTACCACAGGAAAAACACAAGG + Intergenic
1082003009 11:47404086-47404108 TTCAACCCAGGAAAACCCTATGG + Intergenic
1085269126 11:75259824-75259846 TTCACCCCAGGAGCAAACCATGG + Intergenic
1086260049 11:84928725-84928747 ATTATCTCAGGAAAATCCCAAGG - Intronic
1086384611 11:86294242-86294264 TTTACTACAGGAATAAGCCAAGG - Intergenic
1086868146 11:92004762-92004784 TTTAGCAAAGGAAAAAGCCAAGG - Intergenic
1087567911 11:99886398-99886420 TTTACCTAAGGGAAAACCCATGG + Intronic
1092719191 12:11424094-11424116 TTAACTCCAGGAAAAACAAAAGG - Intronic
1096953381 12:55499753-55499775 TTTACTCCCTGCAAAACCCAGGG - Intergenic
1097045644 12:56186072-56186094 TCTACCCCAGAAAGATCCCAGGG + Intronic
1099400269 12:82194857-82194879 GTTACCCCAGTAAAAGGCCATGG - Intergenic
1100059446 12:90555804-90555826 TTTAGCCCATGCTAAACCCAAGG - Intergenic
1102759187 12:115370684-115370706 TTTTCCCCATGCAAAGCCCAAGG + Intergenic
1104280528 12:127372476-127372498 CTTAACCCTGGAAAAACACATGG - Intergenic
1105720478 13:23108649-23108671 TCTACCCCTGCCAAAACCCAAGG + Intergenic
1106883382 13:34156506-34156528 TTTTCCCCAAGGAAAATCCAGGG - Intergenic
1111626034 13:90787916-90787938 TTATCCTCATGAAAAACCCAAGG - Intergenic
1114358407 14:21941356-21941378 TTTTCCCTAGGAAGAACCCGTGG + Intergenic
1116222027 14:42099050-42099072 TTTTCCTCAGGAAAAAGACAAGG + Intergenic
1116596273 14:46850699-46850721 TTTCCCCAGGGAAAAAGCCAAGG - Intronic
1117217851 14:53570260-53570282 TTTACCTCAGGCAAAAGCAATGG - Intergenic
1118694316 14:68369485-68369507 TTTTACCCAGGAAGAAACCATGG - Intronic
1119175543 14:72565512-72565534 TATACCCCAGGAACAAAGCAGGG + Intronic
1120855500 14:89208396-89208418 TTTTCCCCAGTAAAAAGCCCTGG - Intronic
1127616434 15:60690593-60690615 TTTACCCTAACAAAAACACAGGG + Intronic
1133293501 16:4738062-4738084 TTTCCCCCATGTACAACCCAAGG + Intronic
1134756790 16:16674319-16674341 TTTTCCCTAGGAAAGTCCCAGGG + Intergenic
1134989278 16:18684844-18684866 TTTTCCCTAGGAAAGTCCCAGGG - Intergenic
1136678328 16:31936293-31936315 TTCACCCTAGGATAAACTCAAGG + Intergenic
1138331993 16:56222718-56222740 GTGAGCCGAGGAAAAACCCAGGG + Intronic
1139126734 16:64087749-64087771 TTTTCCCAGGGAAAAACCAAGGG - Intergenic
1139126735 16:64087750-64087772 TTTTTCCCAGGGAAAAACCAAGG - Intergenic
1140692944 16:77501798-77501820 TTTACCCAGGGAAAATCCCAGGG - Intergenic
1143134414 17:4703666-4703688 TTTTCCCCTGGAGAAACTCATGG + Intronic
1144664335 17:17091697-17091719 TCTCCCTCAGGAAAAACCGAGGG + Intronic
1145993895 17:29094838-29094860 TTTGCTCCAGGAAAAAGACATGG - Exonic
1147323780 17:39660755-39660777 GTCGCCCCAGGAAAACCCCAGGG - Intronic
1149719566 17:58829369-58829391 TTAACTCCAGGAAAAACAAAAGG - Intronic
1150986986 17:70209424-70209446 TCTGCCCCAGGAAATACCCTGGG - Intergenic
1151058470 17:71061545-71061567 TCATCCACAGGAAAAACCCAAGG - Intergenic
1156670575 18:39464609-39464631 TTCACCCCAGAAACATCCCATGG + Intergenic
1157476540 18:48027665-48027687 TTTTGCTCAGGAAAAAGCCAAGG + Exonic
1161626405 19:5329452-5329474 TTTAAACAAGGAAAACCCCACGG - Intronic
1161642694 19:5434372-5434394 ATTTCCCCACCAAAAACCCATGG + Intergenic
1162891391 19:13735723-13735745 TTTTCCTCAGGCAAACCCCAGGG - Intronic
1167959798 19:53096636-53096658 TTTGCCCCACGCAAGACCCAAGG - Intronic
1167963598 19:53126477-53126499 TTTGCCCCACGCAAGACCCAAGG - Intronic
1168540303 19:57204318-57204340 TTTACCCCAGTAACAACCCTGGG - Intronic
1168595982 19:57677680-57677702 TTTCCCCTAGGAAAAATTCAGGG - Intronic
927622472 2:24676431-24676453 TATACCACAGGCAAAACCAAGGG + Intronic
928292742 2:30053888-30053910 TTGACTCCAGGAAGAACCCTTGG - Intergenic
928447556 2:31346892-31346914 TGTAGCCCAGGCAAAACCCGAGG + Intronic
928459390 2:31456643-31456665 TTTCCCCAAGCAAATACCCAGGG + Intergenic
932652770 2:73577277-73577299 TTTCCCCAAAGAAAAACACAGGG - Intronic
933124183 2:78583623-78583645 TTTACCAAAGGAAAAACCAGAGG - Intergenic
933966808 2:87436817-87436839 TTTTCCCCAGCCAAAGCCCAAGG + Intergenic
933967527 2:87442305-87442327 TTTTCCCCAGCCAAAGCCCAAGG + Intergenic
934174943 2:89570431-89570453 TTTAACCCAGGAATAATCCAAGG - Intergenic
934285259 2:91644783-91644805 TTTAACCCAGGAATAATCCAAGG - Intergenic
936326268 2:111508191-111508213 TTTTCCCCAGCCAAAGCCCAAGG - Intergenic
936574600 2:113642518-113642540 ATTACCTCAGGAGAAGCCCAAGG - Exonic
936900822 2:117480431-117480453 TTTACCCCTGAAAACACCCAAGG - Intergenic
937393457 2:121513839-121513861 CAGCCCCCAGGAAAAACCCAGGG - Intronic
938311458 2:130291611-130291633 TTTACCACTGCAAAAACCCCAGG - Intergenic
938406748 2:131037077-131037099 CTGCCCCCAGGAATAACCCAGGG + Intronic
939055194 2:137356782-137356804 GTAAGCCCAGGCAAAACCCAAGG + Intronic
939532829 2:143386244-143386266 TTTTTCCTTGGAAAAACCCATGG - Intronic
940377216 2:152969883-152969905 TATCCCCCTGGAAAAACCCTGGG + Intergenic
940779595 2:157918764-157918786 TCTATTCCAGGAATAACCCAAGG + Intronic
940996530 2:160156244-160156266 TCTACCCGAGGACAAAGCCAAGG + Intronic
941967754 2:171316365-171316387 TTTACTTTAGGAAAAAACCATGG - Intergenic
942390702 2:175489932-175489954 ATTCCTACAGGAAAAACCCAAGG + Intergenic
945081150 2:206087002-206087024 TTTACCTCAAGAAAAATCTAAGG - Intergenic
946300699 2:218822143-218822165 TTAACCCCAGGAAAAGGTCAGGG + Intergenic
948920620 2:241064366-241064388 TTCACCCGAGGACACACCCAGGG + Intronic
1170994495 20:21338742-21338764 TTTGCTCCAGGATAAAACCAAGG + Intronic
1171224879 20:23434183-23434205 TTGTGCCCAGGAAAAACACAAGG - Intergenic
1172399001 20:34633045-34633067 TTAACCCCAGGAAAAATAAAAGG + Intronic
1173082997 20:39887614-39887636 TGTACCCCAGGACTCACCCAAGG + Intergenic
1176221318 20:63970400-63970422 GTGACCCCAGTAAAACCCCATGG - Intronic
1179636335 21:42713002-42713024 TTTACCCCAGGAAATTTCCTAGG - Intronic
1179985226 21:44917131-44917153 GTCACCCCAGGAAAGAACCAGGG + Intronic
1181083153 22:20427160-20427182 TTTCCCCCAGGAGCAACCCTGGG + Intronic
1184480188 22:44742161-44742183 TTTACCACAGTAAACACACAAGG + Intronic
1184521594 22:44997770-44997792 TTTACCCCAGGCAAAAGAAAAGG - Intronic
1184808120 22:46809501-46809523 TTTAACCCAAGGTAAACCCATGG + Intronic
1185425572 22:50768359-50768381 ATTACCTCAGGAGAAGCCCAAGG + Exonic
949764822 3:7515046-7515068 TTTACACATGGAAAAACCTAAGG - Intronic
950882207 3:16331504-16331526 TTAACTCCAGGAAAAACAGAGGG - Intronic
951697142 3:25456936-25456958 TTTATCCCAGGAGAAATCAAGGG - Intronic
954741223 3:52752300-52752322 TTTGTCCCAGGAGAAACCCAGGG - Exonic
955105155 3:55890965-55890987 TTAAACACAGGAAGAACCCATGG - Intronic
956046493 3:65201252-65201274 TTTACCCAAGGAAATGCCAAAGG + Intergenic
956320666 3:67992885-67992907 ATTACCCAAGGAAGAACACAGGG - Intergenic
959089310 3:101885382-101885404 GTTTCCCCAGGAAAAACACATGG + Intergenic
959529452 3:107416404-107416426 TTTACCACAGCAGAAACCCCAGG + Intergenic
959623131 3:108420678-108420700 TTTACACCTGGTAAAACCAATGG - Intronic
959756913 3:109910489-109910511 TATACCCCAGTACCAACCCAGGG - Intergenic
960761913 3:121081294-121081316 TTTACCCAAGGAAATACCAGAGG - Intronic
960864471 3:122185064-122185086 TTCTCCCCAGGAAATACACATGG - Intronic
964034624 3:152180770-152180792 GTTACCCTAGGTAAGACCCAAGG + Intergenic
968504449 4:965435-965457 TTCACCCCAGGAACACCCCTGGG + Intronic
968772533 4:2516827-2516849 TTTACCCCAGGAGCAAGCCTAGG + Intronic
969468194 4:7370154-7370176 TCTCCCCCAGGAAGAGCCCAGGG - Intronic
970436774 4:16043468-16043490 TTTCTCCCCGGAAAAAGCCAAGG - Intronic
975480543 4:74875037-74875059 GTTGCCCAAGGAAAAACCAATGG - Intergenic
978313079 4:107407627-107407649 TTGTCCCCAGGTAAAATCCAGGG - Intergenic
979348530 4:119618854-119618876 TTTACCCAAGTAAGTACCCATGG - Intronic
979985361 4:127307261-127307283 TTTTCTCCAGGAAAAAGCAAAGG - Intergenic
981662095 4:147179580-147179602 TTTATCCTAGGAAAACCACAGGG + Intergenic
983564707 4:169137402-169137424 TTTACCCTAGGGAAAACAAAAGG - Intronic
983651593 4:170041563-170041585 TCTACCTCATGCAAAACCCAGGG + Intergenic
984651670 4:182277265-182277287 TTCACCCCAGGAAAAATCTGTGG - Intronic
986160836 5:5226893-5226915 GTCACCCCAGGAGAAATCCAGGG + Intronic
988341432 5:29977232-29977254 TTGACCTCAGAAAAAACCTAGGG + Intergenic
988426238 5:31068368-31068390 TTTACCCAAGAAAAACCACAGGG + Intergenic
989189100 5:38652728-38652750 TTTAGCTCAGGAAAAAACAAAGG - Intergenic
994941469 5:106329017-106329039 TTTACCCAGGGAAAGGCCCATGG - Intergenic
995909665 5:117170382-117170404 CCCACCCCAGGAAAAACACATGG - Intergenic
997189977 5:131922835-131922857 TTGACTCCAGGAAAAACAAAAGG - Intronic
998168266 5:139856695-139856717 TACACACCAGGAAACACCCAGGG + Intronic
1000371173 5:160538062-160538084 TTTTACCGAGGAAGAACCCAAGG + Intergenic
1001686169 5:173596561-173596583 TTTCCTCTAGGAAAAACGCAGGG + Intergenic
1003821329 6:9900493-9900515 TTTACCCCAAGAAAATCACATGG + Intronic
1006215674 6:32440574-32440596 TTTACCCCAGGAAAAGGGGAGGG + Intronic
1009683675 6:66929005-66929027 TTGACCCCAGGAGGAACCCTAGG + Intergenic
1009884436 6:69608100-69608122 TTTTCACAAGGAAAACCCCAGGG + Intergenic
1014153487 6:118085335-118085357 TTTGCACCAGGAAAATCCAAGGG - Intronic
1015142301 6:129949077-129949099 TTGAGCCCTGTAAAAACCCAGGG + Intergenic
1015626577 6:135185053-135185075 ATTTCCCCAGAAAAAAGCCATGG - Intronic
1016735924 6:147480096-147480118 TTTACCTCAGGTAAAAACCTAGG - Intergenic
1019094875 6:169571104-169571126 TTTATCCCATGTAAAAACCAAGG + Intronic
1021054761 7:16034326-16034348 GTTACCCAAAAAAAAACCCAGGG + Intergenic
1021971909 7:25973343-25973365 TTAACTCCAGGAAAAACAAAGGG + Intergenic
1022502097 7:30888088-30888110 TTTTCCCCATGAAAAACACTGGG + Intronic
1026844705 7:73692048-73692070 TTCACCCCAGGAAAGACCAGCGG - Intronic
1027365591 7:77454552-77454574 TTATCCCAAGGAAAAACTCATGG + Intergenic
1029550580 7:101235204-101235226 GTTACTCCAGGAAGAAACCAAGG - Intronic
1030815124 7:114026081-114026103 TGTACCCCAGGGAAGACCAATGG + Intronic
1033818055 7:145099369-145099391 TTTACCCCACCACAAAGCCAAGG + Intergenic
1033908913 7:146241700-146241722 ATTACACCAGGAAAAAACTATGG - Intronic
1035561391 8:606629-606651 GATACACCAGGAAAAACCCATGG + Intergenic
1036989084 8:13571195-13571217 TTTACCCCAAGAAAAACAAAAGG - Intergenic
1038723594 8:30059738-30059760 GTTACCCCAGTAAATAGCCACGG + Intergenic
1042122168 8:65499950-65499972 TTTAACCTTGGAACAACCCAAGG - Intergenic
1042335026 8:67621052-67621074 TTTACCCCAATAAAAACCCCAGG + Intronic
1045132187 8:99165619-99165641 TTTACCTCAAGAAAATCCCAGGG + Intronic
1045439497 8:102195506-102195528 CTTACCCCAGGGAAAAGTCATGG + Intergenic
1049606234 8:143530422-143530444 TTTACGCCAGGGAAAAGTCATGG - Intronic
1049960672 9:735052-735074 TCCACCCCAGGAAAAGTCCAGGG - Intronic
1051435017 9:17021434-17021456 TTTTCCCCAGGAACAGCCCCTGG - Intergenic
1056251169 9:84749800-84749822 TTATACTCAGGAAAAACCCATGG + Intronic
1058698600 9:107582138-107582160 ATAACCACAGGATAAACCCAAGG - Intergenic
1059627933 9:116087856-116087878 TCTCCACCAGGAAACACCCATGG - Intergenic
1060512068 9:124241412-124241434 GTTAGCTCAGGAAAAACTCAGGG + Intergenic
1061449858 9:130662044-130662066 TTTACCCCACGACAACCCCGAGG - Intergenic
1062321184 9:135991157-135991179 TCTACCCCAGGTAGATCCCAGGG - Intergenic
1185596304 X:1308925-1308947 TTTACCCCAGGAAAAACCCATGG + Intronic
1186865968 X:13721164-13721186 TTTACCCCAAGGTAACCCCACGG + Intronic
1187969208 X:24642684-24642706 TTGACCACAGTAAATACCCAAGG + Intronic
1192195864 X:69027812-69027834 TGGACCTCTGGAAAAACCCAGGG + Intergenic
1192585195 X:72313658-72313680 TTTACCCAGGGAGAAGCCCAGGG + Intergenic
1193764913 X:85515744-85515766 TTTTCCCCAGTAAAAATCAATGG + Intergenic
1193784532 X:85743571-85743593 TTTACACCAGGAAAACACCATGG + Intergenic
1195980043 X:110567856-110567878 TATACACAAGGAAATACCCATGG + Intergenic
1197069372 X:122276605-122276627 TTTACCTCAGGAGAAACAAATGG - Intergenic
1199612553 X:149631084-149631106 TAAACCCAAGGAAAACCCCAAGG + Intronic
1199880389 X:151969964-151969986 TTTACCACTGGAAAAACTGAGGG + Intronic
1200172563 X:154088416-154088438 TTAATCACAGGAAAAACACAGGG + Intronic
1201476938 Y:14392265-14392287 TCCAACCCAGTAAAAACCCAAGG - Intergenic