ID: 1185599182

View in Genome Browser
Species Human (GRCh38)
Location X:1327310-1327332
Sequence AACCCGGGAGGTGGTTTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185599173_1185599182 15 Left 1185599173 X:1327272-1327294 CCCAGCTACTCAGGAGGCCGAGG 0: 1523
1: 101544
2: 207650
3: 241638
4: 162906
Right 1185599182 X:1327310-1327332 AACCCGGGAGGTGGTTTTGCAGG No data
1185599175_1185599182 14 Left 1185599175 X:1327273-1327295 CCAGCTACTCAGGAGGCCGAGGC 0: 1367
1: 88932
2: 195375
3: 232005
4: 164282
Right 1185599182 X:1327310-1327332 AACCCGGGAGGTGGTTTTGCAGG No data
1185599171_1185599182 23 Left 1185599171 X:1327264-1327286 CCTGTCATCCCAGCTACTCAGGA 0: 500
1: 56077
2: 147736
3: 234007
4: 204281
Right 1185599182 X:1327310-1327332 AACCCGGGAGGTGGTTTTGCAGG No data
1185599177_1185599182 -2 Left 1185599177 X:1327289-1327311 CCGAGGCAGGAGAATCGTTTGAA 0: 71
1: 1751
2: 4920
3: 8584
4: 20432
Right 1185599182 X:1327310-1327332 AACCCGGGAGGTGGTTTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185599182 Original CRISPR AACCCGGGAGGTGGTTTTGC AGG Intergenic
No off target data available for this crispr