ID: 1185600392

View in Genome Browser
Species Human (GRCh38)
Location X:1335193-1335215
Sequence CACTTAAACCCGGCAGGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185600392_1185600403 17 Left 1185600392 X:1335193-1335215 CCTCCGCCTGCCGGGTTTAAGTG No data
Right 1185600403 X:1335233-1335255 TTGGGAGAAGCTGGGATTACAGG No data
1185600392_1185600397 -1 Left 1185600392 X:1335193-1335215 CCTCCGCCTGCCGGGTTTAAGTG No data
Right 1185600397 X:1335215-1335237 GATTCTCCTGCCTCAGCCTTGGG 0: 80
1: 3002
2: 6616
3: 4555
4: 3378
1185600392_1185600399 8 Left 1185600392 X:1335193-1335215 CCTCCGCCTGCCGGGTTTAAGTG No data
Right 1185600399 X:1335224-1335246 GCCTCAGCCTTGGGAGAAGCTGG No data
1185600392_1185600401 9 Left 1185600392 X:1335193-1335215 CCTCCGCCTGCCGGGTTTAAGTG No data
Right 1185600401 X:1335225-1335247 CCTCAGCCTTGGGAGAAGCTGGG No data
1185600392_1185600396 -2 Left 1185600392 X:1335193-1335215 CCTCCGCCTGCCGGGTTTAAGTG No data
Right 1185600396 X:1335214-1335236 TGATTCTCCTGCCTCAGCCTTGG 0: 34
1: 100
2: 216
3: 296
4: 651

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185600392 Original CRISPR CACTTAAACCCGGCAGGCGG AGG (reversed) Intergenic
No off target data available for this crispr