ID: 1185610482

View in Genome Browser
Species Human (GRCh38)
Location X:1391538-1391560
Sequence CCTGCCAGGCATCCACCGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 113}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185610477_1185610482 8 Left 1185610477 X:1391507-1391529 CCCTTCACGGTGGAGGGAGCAAG 0: 1
1: 0
2: 2
3: 21
4: 175
Right 1185610482 X:1391538-1391560 CCTGCCAGGCATCCACCGGAAGG 0: 1
1: 0
2: 0
3: 9
4: 113
1185610473_1185610482 19 Left 1185610473 X:1391496-1391518 CCTTAGAATTACCCTTCACGGTG 0: 1
1: 0
2: 0
3: 6
4: 42
Right 1185610482 X:1391538-1391560 CCTGCCAGGCATCCACCGGAAGG 0: 1
1: 0
2: 0
3: 9
4: 113
1185610470_1185610482 28 Left 1185610470 X:1391487-1391509 CCCTATTGGCCTTAGAATTACCC 0: 1
1: 0
2: 1
3: 11
4: 100
Right 1185610482 X:1391538-1391560 CCTGCCAGGCATCCACCGGAAGG 0: 1
1: 0
2: 0
3: 9
4: 113
1185610478_1185610482 7 Left 1185610478 X:1391508-1391530 CCTTCACGGTGGAGGGAGCAAGA 0: 1
1: 0
2: 0
3: 8
4: 121
Right 1185610482 X:1391538-1391560 CCTGCCAGGCATCCACCGGAAGG 0: 1
1: 0
2: 0
3: 9
4: 113
1185610471_1185610482 27 Left 1185610471 X:1391488-1391510 CCTATTGGCCTTAGAATTACCCT 0: 1
1: 0
2: 0
3: 14
4: 137
Right 1185610482 X:1391538-1391560 CCTGCCAGGCATCCACCGGAAGG 0: 1
1: 0
2: 0
3: 9
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185610482 Original CRISPR CCTGCCAGGCATCCACCGGA AGG Intronic
900610999 1:3544629-3544651 CCTGCCAGGCAGCCCCCAGCAGG + Intronic
902993390 1:20205311-20205333 CCTACCAGGTAGCCACAGGAAGG + Intergenic
903212996 1:21829078-21829100 CCTGCCTGGCATCCTCCCCAGGG - Exonic
903761342 1:25700922-25700944 CCAGCCAGGCACCCCCCAGATGG + Intronic
907240821 1:53080122-53080144 CATGCCTGGCATCCAGGGGAGGG - Intronic
907280683 1:53345142-53345164 CCTGCCAGGCAACCACCCACTGG - Intergenic
912498525 1:110106721-110106743 CCTGCCTGTCATCCACTGGCTGG - Intergenic
913221850 1:116666798-116666820 CCTGCCTGGCATCAACCGTTTGG + Exonic
916578116 1:166085057-166085079 TCTTCCAGGGATCCACCAGAAGG - Intronic
918587459 1:186204174-186204196 CATGCCAGGCATCCATGGAAAGG + Intergenic
923032845 1:230263546-230263568 TCTGCCATGAATCCTCCGGAGGG - Intronic
923261710 1:232273957-232273979 CCTGGGAGGCATCTACCTGATGG + Intergenic
1072625049 10:97105903-97105925 CTTTCCTGGCATCCACCTGATGG - Intronic
1074751270 10:116589611-116589633 ACTTCCAGGCATCCCCAGGATGG - Intergenic
1076746574 10:132517615-132517637 CCTGCCCTGCCCCCACCGGAGGG - Intergenic
1077225548 11:1437708-1437730 CCTGTGAGGCCTCCACCGTAAGG + Intronic
1081630763 11:44688174-44688196 CCTGCCAGGCAGGCACCAGAGGG - Intergenic
1083889016 11:65586611-65586633 ACTGCCAGCCATCTCCCGGAAGG + Intronic
1084457609 11:69277596-69277618 CCTGCCCTGCATCAACCGGCTGG - Intergenic
1084889491 11:72229731-72229753 CCTGTCAGGCATCCAGAAGAAGG + Exonic
1090252093 11:125258770-125258792 CCTGCCAGTCATCCACCCTCTGG - Intronic
1096386757 12:51199408-51199430 TCTTACAGGCATCCACTGGAGGG + Intronic
1104736666 12:131139473-131139495 CCTGCCTTGCATCCACCCGTGGG + Exonic
1119207010 14:72801972-72801994 CCTGCCAGGCATCCACCTTTGGG + Intronic
1122357473 14:101132310-101132332 CCTGGCAAGCAGCCACGGGAGGG - Intergenic
1122838213 14:104441683-104441705 CCACCCAGGCATCCAGCAGACGG - Intergenic
1125683758 15:41550041-41550063 CATGCCAGGCCTCCAACTGAGGG - Intergenic
1125796345 15:42406741-42406763 CCTGCCAGGCACACACTGGCAGG - Intronic
1128063094 15:64747556-64747578 GCAGCCAGGCAGCCACAGGAAGG - Intronic
1129034743 15:72642266-72642288 CCTGCTAGGCATCCACCCTGGGG + Intergenic
1129215139 15:74094950-74094972 CCTGCTAGGCATCCACCCTGGGG - Intergenic
1129390187 15:75216395-75216417 CCTGCTAGGCATCCACCCTGAGG + Intergenic
1129615353 15:77094840-77094862 GCTGCCAGTCACCCACCAGATGG + Intergenic
1129732284 15:77939295-77939317 CCTGCTAGGCATCCACCCTGGGG - Intergenic
1134062210 16:11206049-11206071 CCTGTCTGGCCACCACCGGATGG + Intergenic
1136566361 16:31073114-31073136 CCAGCCAGGCAGCCCCTGGAGGG + Intronic
1137054068 16:35735095-35735117 CCTGGCAGGCTTCCACGGGGAGG - Intergenic
1137054074 16:35735109-35735131 CCTGCCAGGCAGCCCCCAGCAGG + Intergenic
1137564477 16:49524691-49524713 CCTGCCAGGCGTCCTCCCCAGGG + Intronic
1138125553 16:54435638-54435660 ACAGCCATGCATCCACCAGAAGG + Intergenic
1139682524 16:68576149-68576171 ACAGCCAGGCAACCACTGGAAGG + Intergenic
1143894574 17:10126060-10126082 CCTGCCAGGGACCCACAGCAGGG + Intronic
1146544323 17:33725182-33725204 CCTGACAGTCATCCACCTGCAGG - Intronic
1147152871 17:38528386-38528408 CCTTCCAGGCGTGCAGCGGATGG + Intergenic
1149514516 17:57270080-57270102 GCAGCCAGGCATCCACCCTAAGG - Intronic
1152239717 17:79155008-79155030 CGTGCCAGGCATCCAAAGGGTGG + Intronic
1153489180 18:5630216-5630238 CCGGCCAGGCAGCCCCCGGTCGG + Intronic
1153846613 18:9055846-9055868 CCTGCCAGGTATCCACTACAGGG + Intergenic
1154378455 18:13828270-13828292 CCTGGCAGGCCTCAACAGGAAGG - Intergenic
1158115488 18:53990886-53990908 ACTGCCAGGCATCAGCAGGAAGG + Intergenic
1159636955 18:70816644-70816666 CTTGCCAGGCTTCCAGGGGAGGG + Intergenic
1162065684 19:8123931-8123953 CCTGCCTGGCAAGTACCGGATGG - Exonic
1162370324 19:10274907-10274929 CCTGCCTGGGAACAACCGGAAGG + Exonic
1162795498 19:13085375-13085397 CCTTCCAAGCAACCACAGGACGG - Intronic
1165383925 19:35499510-35499532 CCAACCAGGCATCCACAGGCCGG + Intronic
1165447481 19:35864549-35864571 CCTGCCTGGCCTCCACTGGCTGG + Intronic
1167151973 19:47715468-47715490 CATGCCAGACATCCAGAGGAGGG - Intronic
932209294 2:69914480-69914502 CCTGCCAGGCGTCCATCGAATGG - Intronic
937453527 2:122022346-122022368 CAGACCAGGCATCCACAGGAGGG - Intergenic
941673903 2:168323861-168323883 CCTTCCCTGCATCCACCAGAGGG - Intergenic
941812395 2:169767980-169768002 CCTGCCAGGCATCCAGGAGCGGG + Intronic
943718751 2:191180691-191180713 CCTGCCAGCCAGCTACCGGCAGG - Intergenic
945188898 2:207166479-207166501 TCTGCCAGGCATCTAGTGGAGGG - Intronic
948566756 2:238892138-238892160 TGAGCCAGGCAACCACCGGAAGG + Intronic
948943419 2:241207552-241207574 CCTGCAAGGCATGGAGCGGAGGG - Exonic
1171436715 20:25130301-25130323 CCTGAGGGGCATCCACCTGAGGG - Intergenic
1171436730 20:25130346-25130368 CCTGAGGGGCATCCACCTGAGGG - Intergenic
1171436740 20:25130376-25130398 CCTGAGGGGCATCCACCTGAGGG - Intergenic
1171436755 20:25130436-25130458 CCTGAGGGGCATCCACCTGAGGG - Intergenic
1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG + Exonic
1174297703 20:49560881-49560903 CGTGGCAGGGATCCACTGGAGGG + Intronic
1176109112 20:63403131-63403153 CCTGGCAGCCATCCAGAGGAGGG - Intergenic
1176204765 20:63882297-63882319 CCTGCCAGGCGTGCACCTCAGGG + Intronic
1176289096 21:5034836-5034858 ACTGCCAGTCACCCACAGGAAGG + Intronic
1179868139 21:44228768-44228790 ACTGCCAGTCACCCACAGGAAGG - Intronic
1180089920 21:45528632-45528654 CCTTCCAGGAATCCACCTGAGGG + Intronic
1181409141 22:22705844-22705866 TCTGCAAGGAATCCACCGAAAGG + Intergenic
1183858376 22:40652043-40652065 CCTGCCAAGCAGCCAGCGGCCGG - Intergenic
1184799440 22:46750915-46750937 CCTGCCAGGCATCCTGCCCATGG - Intergenic
1185239733 22:49736040-49736062 CGGGCCAGGCATCCACCTGGAGG + Intergenic
953211313 3:40877729-40877751 AGTGCCAGGCATTCACCCGAAGG + Intergenic
962954068 3:140248061-140248083 CCTCCCAGGCATCCAAGGGCAGG + Intronic
968706617 4:2081273-2081295 CCTGCCAGGCATGCATGGGGAGG + Intronic
969647513 4:8441043-8441065 CCGGCCAGGGTTCCCCCGGAGGG + Exonic
985936259 5:3100580-3100602 CCAGCCTGGCCTCCACCGGCAGG - Intergenic
987101423 5:14594583-14594605 CCTGCCTGGCATCCAGCCCAGGG + Intronic
989120894 5:38003654-38003676 CCTGCCAGGAATCTACCTTAAGG - Intergenic
993301469 5:86216064-86216086 CTTGCCAGGCAGCCAACTGAAGG + Intergenic
993477255 5:88380729-88380751 CCTGCCAGCCATCCCCCATATGG - Intergenic
997625961 5:135330714-135330736 CCTTCCAGTGATCCACCTGAAGG - Intronic
999089653 5:148925029-148925051 ACTGGCAGGCATCCAAGGGAAGG + Intronic
1004923827 6:20401315-20401337 CCTGCCAGACATCGTCCGCATGG + Intergenic
1011109019 6:83815664-83815686 CCTGCCAGGCATCCAACAAGAGG - Intergenic
1017026975 6:150189939-150189961 CCCTCCAGGCATCTACAGGAGGG + Intronic
1019186350 6:170222909-170222931 CCTGCCAAGCATCCCCCACAAGG + Intergenic
1019670612 7:2276172-2276194 CCTGCCAGGGAGCCAGCGGCTGG - Intronic
1025873974 7:65462663-65462685 CATTCCAGGCATCCACCAGTGGG - Intergenic
1028964303 7:96784858-96784880 CCTGCTAGGCTTCCAACGTAAGG + Intergenic
1029588804 7:101493324-101493346 CCTGCCAGGCAAACACTGAAGGG - Intronic
1032845087 7:135745418-135745440 CCTGCCAGGGCACCACTGGAAGG - Intronic
1035907027 8:3523476-3523498 GCTGCCAGCCATCCACAGGTGGG - Intronic
1042877502 8:73452430-73452452 CCTGCCATGCATCCCACGGAAGG + Intronic
1044916531 8:97118283-97118305 CCAGCCTGGCAGCCACCAGATGG + Intronic
1047035482 8:120933814-120933836 CCTGCCAGACATCCACAAGCAGG - Intergenic
1047774927 8:128062132-128062154 CCTTCCAGGCATTCACCAGTTGG - Intergenic
1048964355 8:139604556-139604578 CTAGCCAGGCATCCACAGAAGGG + Intronic
1049214520 8:141401647-141401669 CCTGGCAGGAAGTCACCGGAAGG + Intronic
1049780985 8:144428746-144428768 CCTGCCAGGCAGCCACGGGGAGG + Intergenic
1050917664 9:11158149-11158171 CCTGCCAGCCATCCCTCTGAGGG - Intergenic
1051531505 9:18109291-18109313 TCTGCCAGGAATCCCTCGGAAGG + Intergenic
1059042625 9:110830653-110830675 CCGGCCGGGCATCCACCGGTGGG - Intergenic
1061423500 9:130484968-130484990 CCTCCCAGGCAGCCTCCGGAGGG - Intronic
1061947334 9:133916097-133916119 CCTGCCAGGCTTCCTTCAGAAGG - Intronic
1062039380 9:134397029-134397051 CCTGCCAGGCAGAGGCCGGAAGG + Intronic
1062447870 9:136603273-136603295 GCTGCCAGGCCTCCACCTGGGGG + Intergenic
1062637647 9:137500055-137500077 TCTGCCAGGCAGCCACAGGCGGG + Intronic
1185610482 X:1391538-1391560 CCTGCCAGGCATCCACCGGAAGG + Intronic
1185890259 X:3816182-3816204 CCTCCCAGGCAGCGACCGCAGGG - Intergenic
1191141634 X:57121238-57121260 CCTGCCTGGCGTCCACCGCCGGG + Exonic
1191143275 X:57137205-57137227 CCTGCCTGGCGTCCACCGCCGGG + Intronic
1192423396 X:71053648-71053670 CCTGCCAGGAATCAAACGTATGG + Intergenic
1201969899 Y:19780382-19780404 ACTGGGAGGCATCCACCAGAAGG + Intergenic
1202021378 Y:20468218-20468240 TCAGCCAGGAACCCACCGGAAGG + Intergenic