ID: 1185610545

View in Genome Browser
Species Human (GRCh38)
Location X:1391779-1391801
Sequence CGATCGCGGCCTTCCACTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 23}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185610543_1185610545 -3 Left 1185610543 X:1391759-1391781 CCGGCGGCGCGTGGACAAAGCGA 0: 1
1: 0
2: 0
3: 4
4: 20
Right 1185610545 X:1391779-1391801 CGATCGCGGCCTTCCACTTCCGG 0: 1
1: 0
2: 0
3: 5
4: 23
1185610539_1185610545 6 Left 1185610539 X:1391750-1391772 CCCCGGAAGCCGGCGGCGCGTGG 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1185610545 X:1391779-1391801 CGATCGCGGCCTTCCACTTCCGG 0: 1
1: 0
2: 0
3: 5
4: 23
1185610538_1185610545 7 Left 1185610538 X:1391749-1391771 CCCCCGGAAGCCGGCGGCGCGTG 0: 1
1: 0
2: 0
3: 10
4: 73
Right 1185610545 X:1391779-1391801 CGATCGCGGCCTTCCACTTCCGG 0: 1
1: 0
2: 0
3: 5
4: 23
1185610541_1185610545 5 Left 1185610541 X:1391751-1391773 CCCGGAAGCCGGCGGCGCGTGGA 0: 1
1: 0
2: 0
3: 7
4: 71
Right 1185610545 X:1391779-1391801 CGATCGCGGCCTTCCACTTCCGG 0: 1
1: 0
2: 0
3: 5
4: 23
1185610542_1185610545 4 Left 1185610542 X:1391752-1391774 CCGGAAGCCGGCGGCGCGTGGAC 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1185610545 X:1391779-1391801 CGATCGCGGCCTTCCACTTCCGG 0: 1
1: 0
2: 0
3: 5
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185610545 Original CRISPR CGATCGCGGCCTTCCACTTC CGG Intronic
901202559 1:7474970-7474992 CGAGCGCGGCCATACTCTTCAGG - Intronic
922932084 1:229397658-229397680 GGTTCTCGGCCTTCCACCTCTGG + Intergenic
1092478562 12:8839793-8839815 AGATCGCGCCATTGCACTTCAGG - Intronic
1094741621 12:33296256-33296278 TGATCGCTTCCTTCCACTTGAGG + Intergenic
1098369311 12:69739426-69739448 CGACCGCGGCCCTCCGCTCCCGG - Exonic
1108676059 13:52739049-52739071 CCATCGGGGCCTTCTACTTCTGG - Exonic
1119904811 14:78292068-78292090 TGATGGAGGCCTTCAACTTCTGG + Intronic
1127509073 15:59622505-59622527 CGATCACGGCCTCCCCCTGCTGG + Exonic
1143541855 17:7573754-7573776 CGCCCGCGGCCTCCCACATCCGG + Intronic
1161312629 19:3603423-3603445 CGATCGTTGCCCTCCACTCCGGG + Intronic
925415871 2:3669796-3669818 CCATCGCAGCCTCCCACCTCCGG - Intronic
932833068 2:75009258-75009280 TGCTCACTGCCTTCCACTTCGGG + Intergenic
938083467 2:128382731-128382753 CGATCACGCCATTGCACTTCAGG - Intergenic
1174096564 20:48094211-48094233 CGATCCAGGAATTCCACTTCTGG + Intergenic
965205799 3:165718305-165718327 CCATTAGGGCCTTCCACTTCTGG - Intergenic
967574884 3:191077651-191077673 AGATGGCAGCCTGCCACTTCTGG - Intergenic
967893021 3:194376496-194376518 CGATCCCATCATTCCACTTCAGG + Intergenic
991690733 5:69222849-69222871 CGATCTCGGACTTCCACTCCAGG + Intronic
992286111 5:75236983-75237005 CGCGCGCGGCCTCCCACTTCCGG - Intergenic
1018927876 6:168219455-168219477 GGATCGCAGCCTTCCACTGCTGG + Intergenic
1019633152 7:2060655-2060677 CCCTCGTGGCCGTCCACTTCAGG - Intronic
1035567798 8:653079-653101 TGATCCAGCCCTTCCACTTCTGG + Intronic
1038038526 8:23705734-23705756 CCAACGGGGCCTTCCACTTCGGG + Intronic
1043258585 8:78167906-78167928 TGATCCAGTCCTTCCACTTCTGG + Intergenic
1048488565 8:134870841-134870863 CCATCCCTGCCTTCCACCTCTGG - Intergenic
1051503195 9:17800569-17800591 TGATGGCAGCCTTCCACTTAAGG + Intergenic
1053128770 9:35604092-35604114 CGATCCCGGCGGTCCACTCCGGG - Intergenic
1185610545 X:1391779-1391801 CGATCGCGGCCTTCCACTTCCGG + Intronic
1198964696 X:142215109-142215131 AGATCCCGTCCTTCCACTTGAGG - Intergenic