ID: 1185610563

View in Genome Browser
Species Human (GRCh38)
Location X:1391843-1391865
Sequence GGGGACGGGAACCGAGTGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 200}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185610563_1185610568 -8 Left 1185610563 X:1391843-1391865 CCGGCCACTCGGTTCCCGTCCCC 0: 1
1: 0
2: 1
3: 9
4: 200
Right 1185610568 X:1391858-1391880 CCGTCCCCTAGTCCCCGGAGCGG 0: 1
1: 0
2: 0
3: 9
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185610563 Original CRISPR GGGGACGGGAACCGAGTGGC CGG (reversed) Intronic