ID: 1185618338

View in Genome Browser
Species Human (GRCh38)
Location X:1436924-1436946
Sequence CCATCGTCGTGGAGACTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 63}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185618333_1185618338 9 Left 1185618333 X:1436892-1436914 CCAGGTGGCTTAAACTACAGACA 0: 1
1: 12
2: 87
3: 263
4: 1387
Right 1185618338 X:1436924-1436946 CCATCGTCGTGGAGACTGGAAGG 0: 1
1: 0
2: 0
3: 0
4: 63
1185618332_1185618338 10 Left 1185618332 X:1436891-1436913 CCCAGGTGGCTTAAACTACAGAC 0: 1
1: 3
2: 14
3: 119
4: 1207
Right 1185618338 X:1436924-1436946 CCATCGTCGTGGAGACTGGAAGG 0: 1
1: 0
2: 0
3: 0
4: 63
1185618328_1185618338 29 Left 1185618328 X:1436872-1436894 CCATAGCAAAGTCCTACAACCCA 0: 1
1: 0
2: 2
3: 17
4: 201
Right 1185618338 X:1436924-1436946 CCATCGTCGTGGAGACTGGAAGG 0: 1
1: 0
2: 0
3: 0
4: 63
1185618331_1185618338 17 Left 1185618331 X:1436884-1436906 CCTACAACCCAGGTGGCTTAAAC 0: 1
1: 0
2: 6
3: 33
4: 221
Right 1185618338 X:1436924-1436946 CCATCGTCGTGGAGACTGGAAGG 0: 1
1: 0
2: 0
3: 0
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185618338 Original CRISPR CCATCGTCGTGGAGACTGGA AGG Intronic
900298767 1:1966161-1966183 CCCTCTTCGCGGAGCCTGGAGGG - Intronic
901148670 1:7085820-7085842 CCATCAGCTTGGGGACTGGATGG + Intronic
904949272 1:34223168-34223190 CCAGCGTCATGAAGTCTGGATGG + Intergenic
906513142 1:46423044-46423066 CCATTGAGATGGAGACTGGATGG + Intergenic
908061332 1:60352921-60352943 TCATAGTCCTGAAGACTGGAAGG - Intergenic
915257164 1:154642672-154642694 TCATGGTCCTGGAGGCTGGAAGG + Intergenic
922507779 1:226136464-226136486 CCAGCGGAGGGGAGACTGGAGGG - Intergenic
923800411 1:237203847-237203869 CCATGGAGGTGGAGACTGCACGG - Intronic
1064263981 10:13809641-13809663 CCCTCGTCCTGGAGCCTGCAGGG - Intronic
1070603977 10:77885641-77885663 CCATAGTGGTGCAGGCTGGAGGG - Intronic
1087944821 11:104146006-104146028 TCATAGTCCTGGAGGCTGGAAGG - Intronic
1088694727 11:112356888-112356910 CCATCCCCCTGGATACTGGACGG + Intergenic
1091999750 12:5022491-5022513 GCATCTTCCTGGAGACAGGAAGG + Intergenic
1092118377 12:6025820-6025842 CCATTGTCATGGGGGCTGGAAGG - Intronic
1106694093 13:32151696-32151718 TCATCGTCGTGAAGACTTGCTGG + Intronic
1120237186 14:81905315-81905337 TCATGGTCCTGGAGACTGGGAGG + Intergenic
1121088090 14:91162002-91162024 CCAGGGTCTTGGAGCCTGGAGGG + Intronic
1128131434 15:65229674-65229696 CCATCGTCGGGGAGATGGAATGG + Intergenic
1129230717 15:74195836-74195858 GCATCGTTGTAAAGACTGGATGG + Intronic
1133855128 16:9542542-9542564 CCATCCCCGTTGAGAATGGAGGG + Intergenic
1134746216 16:16590922-16590944 CCATCTTGGTGGAGCCTAGAGGG + Intergenic
1134999265 16:18762778-18762800 CCATCTTGGTGGAGCCTAGAGGG - Intergenic
1139655627 16:68385557-68385579 CCAAGGTGGTGGTGACTGGATGG - Intronic
1140907260 16:79419462-79419484 CCATCGGCATGGAAACTGTAAGG - Intergenic
1141725873 16:85788014-85788036 CCATCTCCCTGGACACTGGAGGG + Intronic
1148266548 17:46230671-46230693 CCACCTTTGTGGAAACTGGAAGG - Intergenic
1149911980 17:60575057-60575079 CCTTGGAGGTGGAGACTGGAGGG + Intronic
1152913518 17:83019487-83019509 CCAAAGTCATGGGGACTGGACGG + Intronic
1168712477 19:58509804-58509826 CCGTGGTCCTGTAGACTGGAGGG + Intronic
927793189 2:26026933-26026955 ACAAAGTCCTGGAGACTGGAGGG + Intergenic
929701605 2:44168027-44168049 TCTTCGGCGTGGAGACGGGAAGG - Intronic
935103853 2:100021167-100021189 CCATTATCGGGGAGAGTGGAGGG - Intronic
937354310 2:121188323-121188345 CCATCATCCTGGAGACTTGTAGG - Intergenic
941911790 2:170771064-170771086 GCGTCGCCGTGGAGACTGCACGG - Intergenic
943355390 2:186849177-186849199 CCGTCGTCTTGGAGACCGGCTGG - Intronic
1173932839 20:46835999-46836021 CCATCTTCATGGGGACAGGAAGG + Intergenic
1175585204 20:60133638-60133660 CCATCGTGAAGGAGTCTGGAAGG - Intergenic
1178133282 21:29597582-29597604 GCACCATCGTGGAGACTGGCTGG + Intronic
1178158986 21:29888798-29888820 CCATCATAGTGGAGACCAGATGG - Intronic
1182418836 22:30238761-30238783 CCAGCCTCCTGGAGACTGGGCGG + Intergenic
1184431561 22:44444172-44444194 GCATCTTCATGGAGACTGGTGGG + Intergenic
1184487049 22:44786059-44786081 CCATGGTGCTGGACACTGGATGG + Intronic
950624899 3:14238037-14238059 ACATGATTGTGGAGACTGGAGGG - Intergenic
953912623 3:46900576-46900598 CCCTCGTGGATGAGACTGGATGG - Intronic
953960912 3:47265011-47265033 ACATAGTTCTGGAGACTGGAAGG - Intronic
957245490 3:77711301-77711323 CCACAGAGGTGGAGACTGGAGGG - Intergenic
965912862 3:173802871-173802893 CTTTTGTCATGGAGACTGGAGGG + Intronic
970407006 4:15773559-15773581 CCATCCTTGAGGAGAGTGGATGG + Intergenic
973295986 4:48521347-48521369 CCATTCTGGTGTAGACTGGAAGG - Intronic
981334988 4:143559724-143559746 CCAACGTCGTTGAAGCTGGAGGG - Intergenic
985025636 4:185736846-185736868 CCATAGTTGGGGAGACTGAAAGG + Intronic
997840022 5:137230977-137230999 CCATGGTAGTGGATACAGGAAGG - Intronic
1003495974 6:6663524-6663546 CCATCGTGGTGGAGACCAGCTGG + Intergenic
1015949155 6:138533894-138533916 TCAGCTTCGTGGTGACTGGAAGG - Intronic
1029727353 7:102415881-102415903 CCAGCATGGTGGAGACCGGAAGG - Intronic
1037473762 8:19237122-19237144 CCTTCATCGTGGAGAAGGGAAGG - Intergenic
1043164908 8:76891551-76891573 ACATCTTCGTGGGGAGTGGAGGG + Intergenic
1051351898 9:16205101-16205123 GCATCCTCGGGGAGTCTGGAGGG + Intronic
1051930240 9:22376344-22376366 ACATGGTCTAGGAGACTGGAAGG + Intergenic
1057905010 9:98976516-98976538 CCAGCATCGTGGAGATGGGAGGG + Intronic
1062442556 9:136577437-136577459 CCTTCTTCCTGGAGCCTGGATGG - Intergenic
1185618338 X:1436924-1436946 CCATCGTCGTGGAGACTGGAAGG + Intronic
1197199089 X:123733179-123733201 CCAACGACGTGGAGACTCGCGGG + Intergenic
1200134583 X:153868713-153868735 CCATCCTCGTCCAGCCTGGAGGG + Exonic