ID: 1185619194

View in Genome Browser
Species Human (GRCh38)
Location X:1442962-1442984
Sequence TTGCTCTGTCAGAGGGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619194_1185619198 -6 Left 1185619194 X:1442962-1442984 CCATCTCCCCTCTGACAGAGCAA No data
Right 1185619198 X:1442979-1443001 GAGCAAAAGCATCGCCATCTTGG No data
1185619194_1185619200 13 Left 1185619194 X:1442962-1442984 CCATCTCCCCTCTGACAGAGCAA No data
Right 1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619194 Original CRISPR TTGCTCTGTCAGAGGGGAGA TGG (reversed) Intronic