ID: 1185619196

View in Genome Browser
Species Human (GRCh38)
Location X:1442969-1442991
Sequence GATGCTTTTGCTCTGTCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619196_1185619200 6 Left 1185619196 X:1442969-1442991 CCCTCTGACAGAGCAAAAGCATC No data
Right 1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG No data
1185619196_1185619203 25 Left 1185619196 X:1442969-1442991 CCCTCTGACAGAGCAAAAGCATC No data
Right 1185619203 X:1443017-1443039 TTGGAGAGACACCACCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619196 Original CRISPR GATGCTTTTGCTCTGTCAGA GGG (reversed) Intronic