ID: 1185619200

View in Genome Browser
Species Human (GRCh38)
Location X:1442998-1443020
Sequence TTGGACACACACCGCCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619196_1185619200 6 Left 1185619196 X:1442969-1442991 CCCTCTGACAGAGCAAAAGCATC No data
Right 1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG No data
1185619195_1185619200 7 Left 1185619195 X:1442968-1442990 CCCCTCTGACAGAGCAAAAGCAT No data
Right 1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG No data
1185619193_1185619200 20 Left 1185619193 X:1442955-1442977 CCTCTGACCATCTCCCCTCTGAC No data
Right 1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG No data
1185619190_1185619200 30 Left 1185619190 X:1442945-1442967 CCGCATCTCCCCTCTGACCATCT No data
Right 1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG No data
1185619191_1185619200 22 Left 1185619191 X:1442953-1442975 CCCCTCTGACCATCTCCCCTCTG No data
Right 1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG No data
1185619192_1185619200 21 Left 1185619192 X:1442954-1442976 CCCTCTGACCATCTCCCCTCTGA No data
Right 1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG No data
1185619194_1185619200 13 Left 1185619194 X:1442962-1442984 CCATCTCCCCTCTGACAGAGCAA No data
Right 1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG No data
1185619197_1185619200 5 Left 1185619197 X:1442970-1442992 CCTCTGACAGAGCAAAAGCATCG No data
Right 1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619200 Original CRISPR TTGGACACACACCGCCATCT TGG Intronic