ID: 1185619203

View in Genome Browser
Species Human (GRCh38)
Location X:1443017-1443039
Sequence TTGGAGAGACACCACCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 9, 3: 50, 4: 162}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619197_1185619203 24 Left 1185619197 X:1442970-1442992 CCTCTGACAGAGCAAAAGCATCG 0: 1
1: 0
2: 3
3: 12
4: 124
Right 1185619203 X:1443017-1443039 TTGGAGAGACACCACCATCTTGG 0: 1
1: 0
2: 9
3: 50
4: 162
1185619196_1185619203 25 Left 1185619196 X:1442969-1442991 CCCTCTGACAGAGCAAAAGCATC 0: 1
1: 0
2: 2
3: 24
4: 198
Right 1185619203 X:1443017-1443039 TTGGAGAGACACCACCATCTTGG 0: 1
1: 0
2: 9
3: 50
4: 162
1185619195_1185619203 26 Left 1185619195 X:1442968-1442990 CCCCTCTGACAGAGCAAAAGCAT 0: 1
1: 0
2: 2
3: 24
4: 319
Right 1185619203 X:1443017-1443039 TTGGAGAGACACCACCATCTTGG 0: 1
1: 0
2: 9
3: 50
4: 162
1185619199_1185619203 1 Left 1185619199 X:1442993-1443015 CCATCTTGGACACACACCGCCAT 0: 19
1: 27
2: 46
3: 99
4: 214
Right 1185619203 X:1443017-1443039 TTGGAGAGACACCACCATCTTGG 0: 1
1: 0
2: 9
3: 50
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619203 Original CRISPR TTGGAGAGACACCACCATCT TGG Intronic
903425685 1:23252561-23252583 GCTGAGAGAGACCACCATCTAGG + Intergenic
905421487 1:37848872-37848894 TAGGAGAGTCAACAACATCTTGG + Intronic
905992378 1:42349457-42349479 TTTGAGAGACACCTGCATTTAGG - Intergenic
905999339 1:42410466-42410488 TTGGAGAAAAACTCCCATCTGGG + Intronic
907525706 1:55052804-55052826 ATGGAGAGAGACCAGCGTCTGGG - Intronic
909411963 1:75364608-75364630 TTGGGAAAACACCACCATCCAGG - Intronic
911999083 1:104807462-104807484 TAGGAGAGACAAGACCAGCTTGG - Intergenic
912265651 1:108154557-108154579 TTGGAGTGACACCTCCATGAAGG - Intronic
912704816 1:111904159-111904181 TTGGCGGGACTCCACCATCTGGG - Intronic
917731642 1:177880782-177880804 TTTCAGAGACACCATCATGTAGG - Intergenic
922289661 1:224199763-224199785 TTGAACAGACAGCACCGTCTGGG + Intergenic
923391275 1:233515828-233515850 TGGGAGAGGCACCAACAGCTGGG - Intergenic
1064097221 10:12432865-12432887 TTGCCGAGACGGCACCATCTTGG - Intronic
1068050099 10:51939609-51939631 TTTGAGAAACACCACTATCTTGG + Intronic
1069536204 10:69255290-69255312 TTAGAGAGACACTCCCAACTGGG - Intronic
1072956772 10:99893795-99893817 TGGGAGATACACTAGCATCTTGG - Intronic
1076772141 10:132671521-132671543 TTGGAAGGACACAACCTTCTTGG + Intronic
1077072667 11:683448-683470 AGGGAGAGACCCCACGATCTGGG - Intronic
1077277981 11:1725617-1725639 GTGCAGTGGCACCACCATCTCGG - Intergenic
1077343625 11:2036780-2036802 TTGGAAGGACCCCATCATCTGGG + Intergenic
1081085299 11:38792108-38792130 AGGGACAGACAACACCATCTAGG + Intergenic
1087267433 11:96076283-96076305 TTGGAGAGACACACCAACCTTGG + Intronic
1089852921 11:121515831-121515853 TAGTAGAGACAGCACCATGTTGG + Intronic
1202826611 11_KI270721v1_random:91969-91991 TTGGAAGGACCCCATCATCTGGG + Intergenic
1093163791 12:15781790-15781812 TTGGAGAGTCCCCACCAGCAAGG - Intronic
1093930299 12:24949185-24949207 TGGGAGAGACTCCACCATCTGGG - Intronic
1095230717 12:39735952-39735974 TTGGAGAAACACTGCCAGCTTGG + Intronic
1096870479 12:54589236-54589258 TTGGGGAGAGAGGACCATCTGGG + Intergenic
1096917134 12:55045419-55045441 TTGGGGAGACACGAGCATTTAGG + Intergenic
1097816961 12:64085501-64085523 TGTGAGAGTCACCACCATTTAGG - Intronic
1098979110 12:76935937-76935959 TTGGCCAGACAAGACCATCTAGG - Intergenic
1101257015 12:102988701-102988723 TTAGAGAACCAGCACCATCTGGG - Intergenic
1101569535 12:105940478-105940500 TCGAAGACACACCACCATCCTGG + Intergenic
1103503012 12:121419512-121419534 TTGGGTATACACCACCATTTGGG + Intronic
1109441971 13:62386185-62386207 TTGCAGTGACACCACAATGTGGG - Intergenic
1111584986 13:90272187-90272209 TTGGACAGAAATCATCATCTGGG - Intergenic
1113018714 13:105857723-105857745 AAGGAGAGGCACCACCAGCTGGG + Intergenic
1113034775 13:106037100-106037122 TGGGAGAGCCACCAGCAGCTGGG - Intergenic
1113462427 13:110491499-110491521 ATGGAGAGAAACAACCACCTGGG + Intronic
1116244683 14:42394489-42394511 TTGAAGGGACACCACTATTTTGG - Intergenic
1122286876 14:100657624-100657646 TTGGAGAGACATTAGCATCCAGG - Intergenic
1123165465 14:106321284-106321306 TTTAAGAGACACCACTATCATGG + Intergenic
1123720376 15:23055785-23055807 ATGGAGAGACTCCTTCATCTTGG - Intergenic
1126723439 15:51606630-51606652 TGGGTAAGATACCACCATCTTGG + Intronic
1127286539 15:57538482-57538504 TTGGAGAGTCACCATTATCCTGG + Intronic
1127501114 15:59554982-59555004 TTGGTGTGACACCACACTCTGGG - Intergenic
1131556978 15:93408148-93408170 TTGGAGAGACACCGGCAACAGGG + Intergenic
1133459838 16:5977785-5977807 ATTAAGAGACACCACCATCAAGG + Intergenic
1134321225 16:13166173-13166195 TTGGAGAAAAGCCACAATCTTGG - Intronic
1139966332 16:70747574-70747596 TGGGTGAGACCCCACCACCTCGG - Intronic
1141252200 16:82368952-82368974 TTGGAGAGAAAGCACCATACTGG - Intergenic
1141252203 16:82368981-82369003 TTGGAGAGAAAGCACCATACTGG - Intergenic
1144921478 17:18767870-18767892 TGGGACAGACACTACCTTCTTGG - Intronic
1147338469 17:39740454-39740476 TTGGAGAGAAGCCAGCATCCCGG - Intronic
1148496822 17:48058040-48058062 TTGGCCAGACTCCCCCATCTTGG - Intronic
1149554967 17:57566993-57567015 TTGGAGAAACATCACCCTCCAGG - Intronic
1149948715 17:60960819-60960841 CTGCAGAAACACCGCCATCTTGG - Intronic
1150266011 17:63832882-63832904 CTGGAGGGAGACCACCCTCTGGG - Exonic
1158307488 18:56122501-56122523 TTGGTGAGCCATCATCATCTAGG + Intergenic
1158444384 18:57506500-57506522 TTGGAGAGAGACCATCCTGTAGG - Intergenic
1160842044 19:1150571-1150593 TGGGGGAGACACCACCAGCCGGG + Intronic
1161343047 19:3753140-3753162 GTGGAGAGACAGCCGCATCTTGG + Intronic
1161698361 19:5782621-5782643 TTGGAGACACACAGCCATCAGGG - Intergenic
1163395637 19:17059106-17059128 GTGGAGAGACAGCAGCAGCTGGG + Intronic
1166186097 19:41140099-41140121 TTGGAGAGAGACAACAGTCTTGG - Intergenic
925024535 2:597292-597314 CTGGGGACACACCACCATCAAGG + Intergenic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
926812388 2:16767054-16767076 TTGATGAAACACCACCATATTGG + Intergenic
929030148 2:37642560-37642582 CTGGAGAGAAACCATCATGTTGG + Exonic
933588609 2:84207160-84207182 TTGGAGAGAATACACTATCTTGG + Intergenic
934517475 2:94997939-94997961 TTGGCATGACCCCACCATCTTGG - Intergenic
940610196 2:155980393-155980415 TGGGAGACACACATCCATCTTGG + Intergenic
940656608 2:156494712-156494734 TGGGAAAAACACCACCATCATGG + Intronic
946943479 2:224794978-224795000 CTGGAGATCCACCAGCATCTCGG + Exonic
1168837276 20:885544-885566 TGGGAGGGACACCAGCAACTGGG + Intronic
1170599315 20:17828789-17828811 TTGGAGAGACCCCACCACGATGG - Intergenic
1170775118 20:19368404-19368426 ATGAAGTGACACCACCATCAAGG - Intronic
1172927321 20:38550350-38550372 TTTGAGAGACACCACAAAATTGG + Intronic
1173389787 20:42621745-42621767 TTTGAGAGTCACCAGGATCTAGG - Intronic
1174046807 20:47739531-47739553 TTGATCAGACACCACCTTCTTGG + Intronic
1177779470 21:25607345-25607367 CTAGACAGACACCACTATCTAGG + Intronic
1179299007 21:40089900-40089922 TTGGAGATTGACCACCATTTAGG + Intronic
1182452436 22:30429432-30429454 TGGGGCTGACACCACCATCTTGG - Intergenic
953807716 3:46085806-46085828 TTGGTGTGACAGCAGCATCTGGG + Intergenic
956495942 3:69825853-69825875 TTGGAGGGAAACAACCAGCTAGG - Intronic
957862451 3:85972550-85972572 TTGGAGAGAAACAAGCAGCTTGG + Intronic
959115986 3:102178545-102178567 TTGGAGTGACCCCACTATTTTGG - Intronic
963909812 3:150807214-150807236 TTGGAGAGACACCAACCTTCCGG - Intergenic
967216156 3:187212351-187212373 TTGGAGAGCCATCAGCATTTAGG + Intergenic
969964054 4:10976041-10976063 TTGAGGAGACAGCACCATGTTGG - Intergenic
970652773 4:18196909-18196931 CTGGAGAGACAGCTCCAGCTGGG + Intergenic
973886805 4:55330590-55330612 TTGGAGAGTCACCTCCTTGTGGG - Intergenic
974286777 4:59879108-59879130 CTGGAGAGACAGCTCCAGCTGGG - Intergenic
977953774 4:103003524-103003546 TTGTAGAAACACCTCAATCTAGG + Intronic
979273944 4:118793562-118793584 TTGGAGAGCCACCAACATTAGGG - Intronic
982045432 4:151440610-151440632 TAGGATAGTCACCACCATCATGG + Intronic
982675729 4:158373859-158373881 TTAGAAAGACATCACCATATCGG + Intronic
985829326 5:2216535-2216557 TTGGAGAGCCTCCTCCATCCAGG + Intergenic
986773054 5:10990635-10990657 TTTAATAAACACCACCATCTGGG - Intronic
988995060 5:36706807-36706829 TTGGAGAACCACTGCCATCTGGG - Intergenic
990485031 5:56249760-56249782 TTGGAGAGACAATAATATCTTGG - Intergenic
1000990225 5:167904197-167904219 TTGGAGAGTCAATACCATCAAGG + Intronic
1001529365 5:172451658-172451680 CTGGAGAGACAGCATCAGCTGGG - Intronic
1004454603 6:15780276-15780298 TTGGAAAGACACCATCATCCTGG - Intergenic
1005706075 6:28454838-28454860 TTGGAGACACAGCACCATTTAGG + Intergenic
1005942512 6:30571401-30571423 TTGGAGAGCCAGCCCCATCGGGG + Exonic
1006704522 6:36007462-36007484 ATGGAGAGACACCATAATCATGG + Intronic
1010917455 6:81637861-81637883 TTGCACTTACACCACCATCTTGG + Intronic
1015374665 6:132496070-132496092 TTGGAAAGACAGAACCTTCTAGG - Intronic
1016665347 6:146632980-146633002 TTTGAGAGTCATCAGCATCTAGG - Intronic
1017785904 6:157757070-157757092 CTAGAGAGGCAGCACCATCTTGG - Intronic
1017881385 6:158565018-158565040 TGTGAGAGACACCTTCATCTCGG - Intronic
1018863527 6:167730644-167730666 TTGGGGAGAGACCACCATCCAGG - Intergenic
1021409667 7:20315749-20315771 CTGGAGGGACACAAACATCTAGG - Intergenic
1026972050 7:74474412-74474434 TGGGAGAGCCACTCCCATCTTGG + Intronic
1029277149 7:99413046-99413068 TTGGAGAGGCCTCACCATCATGG + Intronic
1031150189 7:118045276-118045298 CTGGAAATATACCACCATCTGGG + Intergenic
1033574998 7:142672569-142672591 TTTTGGAGACACCATCATCTTGG + Intergenic
1034688422 7:152994651-152994673 TTGGGGAGACACCAACATTCAGG - Intergenic
1035218512 7:157390121-157390143 TGGGACAGCAACCACCATCTGGG - Intronic
1038692735 8:29777821-29777843 TAGGAAATAGACCACCATCTTGG - Intergenic
1044585788 8:93868324-93868346 TTGGACAGCCAACACCATTTTGG - Intronic
1045846422 8:106642394-106642416 GTGGAGAGCCACCACCACCCAGG - Intronic
1047715190 8:127588828-127588850 TTCGGGAGTCACCACCATTTAGG - Intergenic
1047933297 8:129751460-129751482 TTGCATAGAAACCACCAACTTGG + Intronic
1047946196 8:129883241-129883263 TAGGAAATACACCAACATCTTGG + Intronic
1050035196 9:1427972-1427994 ATGAAGAAACACCACCATCAGGG + Intergenic
1050603115 9:7272494-7272516 TTGGCGAGGCACATCCATCTAGG + Intergenic
1050897398 9:10900483-10900505 TTGGGGAGACCTCACCATCATGG + Intergenic
1053002079 9:34582622-34582644 ATGCAGAGACACCACCACCCAGG + Intronic
1059876465 9:118640957-118640979 TTGGAGAGACAAGGCCAACTTGG + Intergenic
1062077943 9:134602295-134602317 TTGGTGAGACACCAGGAGCTGGG - Intergenic
1062711991 9:137980163-137980185 ATGCAGAGACATCACCAACTTGG - Intronic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619203 X:1443017-1443039 TTGGAGAGACACCACCATCTTGG + Intronic
1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG + Intronic
1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic
1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG + Intronic
1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619289 X:1443594-1443616 TTGGACAGACACCGCCATCGTGG + Intronic
1185619292 X:1443613-1443635 GTGGACAGACACCGCCATCGTGG + Intronic
1185619295 X:1443632-1443654 GTGGACAGACACCGCCATCATGG + Intronic
1185619336 X:1443881-1443903 GTGGACAGACACCCCCATCATGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619344 X:1443919-1443941 TTGGACAGACACCCCCGTCTTGG + Intronic
1185619349 X:1443938-1443960 TTGGACAGACACTGCCATGTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619879 X:1447327-1447349 TTGGATAAGCACCACCATCTTGG + Intronic
1185619886 X:1447381-1447403 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619891 X:1447419-1447441 TTGGATAAGCACCACCATCTTGG + Intronic
1185619899 X:1447473-1447495 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619906 X:1447511-1447533 TGGGAGAAGCACCACCATCTTGG + Intronic
1185619912 X:1447546-1447568 TTGGACACACACGGCCATCTTGG + Intronic
1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619922 X:1447619-1447641 TTGGATAAGCACCACCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619930 X:1447673-1447695 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619939 X:1447746-1447768 TTTGACACACACCACCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619945 X:1447784-1447806 TTGGATAAGCACCACCATCTTGG + Intronic
1185619949 X:1447822-1447844 TTGGATAAGCACTACCATCTTGG + Intronic
1185619960 X:1447895-1447917 TTGGACAAGCACCGCCATCTTGG + Intronic
1185619966 X:1447931-1447953 TTGGATACACAACACCATCTTGG + Intronic
1185619968 X:1447950-1447972 TTGGAAAAGCACCACCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619974 X:1447988-1448010 TTGGATAAGAACCACCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619982 X:1448042-1448064 TTGGATAAGAACCACCATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185619989 X:1448096-1448118 TTGGATAAGCACCACCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185619997 X:1448150-1448172 TTGGATAAGCACCACCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620003 X:1448188-1448210 TTGGATAAGCACCACCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620010 X:1448242-1448264 TTGGATAAGCACCACCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620017 X:1448296-1448318 TTGGATAAGCACCACCATCTTGG + Intronic
1185620029 X:1448369-1448391 TTGGACAAGCACCACCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185620041 X:1448441-1448463 TTGGAAAAGCACCACCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620047 X:1448495-1448517 TTGGATAAGCACCACCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620055 X:1448552-1448574 TTGGATAAGCACCACCATCTTGG + Intronic
1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG + Intronic
1185620063 X:1448606-1448628 TTGGATAAGCACCACCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620069 X:1448644-1448666 TTGGATAAGCACCACCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1185620076 X:1448698-1448720 TTGGAGAAGCACCACCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1185620085 X:1448752-1448774 TTGGATAAGCACCACCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG + Intronic
1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1187736015 X:22304253-22304275 TTGGAGAGAGACTGCCATGTTGG + Intergenic
1188041096 X:25370222-25370244 CTGGAGAGGCTCCACAATCTGGG - Intergenic
1190217788 X:48491670-48491692 GTGTACAGACACCACAATCTAGG - Intergenic
1194188635 X:90807661-90807683 TTGGAGAGGCCAAACCATCTGGG - Intergenic
1195579180 X:106482268-106482290 TTGCCCAGACACCTCCATCTTGG - Intergenic
1196979357 X:121194671-121194693 CTGGAAAGACACCAACCTCTGGG - Intergenic
1197328771 X:125127615-125127637 TTGGAGAGGCAGCCCCATCCAGG + Intergenic
1197893266 X:131286371-131286393 ATGGAGACACGCCAGCATCTTGG + Intronic
1200535219 Y:4389556-4389578 TTGGAGAGGCCAAACCATCTGGG - Intergenic
1201535701 Y:15045892-15045914 TTGGAGAGACCTCACAATCATGG - Intergenic
1201752743 Y:17451131-17451153 TTGGAGAAAGACCACAATTTGGG - Intergenic