ID: 1185619206

View in Genome Browser
Species Human (GRCh38)
Location X:1443036-1443058
Sequence TTGGACGCATACCACCATCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 47}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619201_1185619206 4 Left 1185619201 X:1443009-1443031 CCGCCATCTTGGAGAGACACCAC 0: 1
1: 0
2: 16
3: 59
4: 199
Right 1185619206 X:1443036-1443058 TTGGACGCATACCACCATCGTGG 0: 1
1: 0
2: 1
3: 6
4: 47
1185619199_1185619206 20 Left 1185619199 X:1442993-1443015 CCATCTTGGACACACACCGCCAT 0: 19
1: 27
2: 46
3: 99
4: 214
Right 1185619206 X:1443036-1443058 TTGGACGCATACCACCATCGTGG 0: 1
1: 0
2: 1
3: 6
4: 47
1185619202_1185619206 1 Left 1185619202 X:1443012-1443034 CCATCTTGGAGAGACACCACCAT 0: 1
1: 0
2: 21
3: 91
4: 234
Right 1185619206 X:1443036-1443058 TTGGACGCATACCACCATCGTGG 0: 1
1: 0
2: 1
3: 6
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619206 Original CRISPR TTGGACGCATACCACCATCG TGG Intronic
900985619 1:6071507-6071529 TGGGATGCATGCCACCATGGTGG + Intronic
902302560 1:15512374-15512396 TTGGACGCGGCCCACCATCCTGG - Intronic
1070415847 10:76188544-76188566 TTAGACACATTCCACCATCTGGG - Intronic
1072640740 10:97209369-97209391 TTGGACCCCTTCCACCATAGAGG - Intronic
1093760509 12:22904139-22904161 TTGGAGGCATACCATCAGAGAGG + Intergenic
1116890150 14:50260084-50260106 TTGAACGTATACCACCAGCTTGG - Intronic
1140901914 16:79375845-79375867 TGGGAAGCATACCATCATGGTGG + Intergenic
1141897342 16:86966672-86966694 TGGGAAGCATTCCACCATGGCGG - Intergenic
1160389596 18:78520142-78520164 TTGGACGCAGCCCACCATCCAGG - Intergenic
949079395 2:242084762-242084784 TTGTACCCATGGCACCATCGTGG + Intergenic
1181980631 22:26763497-26763519 TTGGACACAGATCACCATAGAGG - Intergenic
1185373177 22:50470165-50470187 TTGGCCCCAAACCACCATCTGGG + Intronic
974990763 4:69085753-69085775 TTGGACACATACCACCAACCAGG - Intronic
979967648 4:127094720-127094742 TTGGACTCATACAACCATGTAGG - Intergenic
1024588201 7:50859095-50859117 TTGGACACCTTCCACCATGGAGG + Intergenic
1028803870 7:95001390-95001412 TTGTACGCTTATCACCATCATGG - Intronic
1032395554 7:131586787-131586809 TTGGAGGCATAACTCCAGCGTGG + Intergenic
1051850931 9:21507024-21507046 TTGGAAGCAAGCCACCTTCGTGG - Intergenic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619206 X:1443036-1443058 TTGGACGCATACCACCATCGTGG + Intronic
1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG + Intronic
1185619225 X:1443169-1443191 GTGGACACACACCGCCATCGTGG + Intronic
1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG + Intronic
1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG + Intronic
1185619289 X:1443594-1443616 TTGGACAGACACCGCCATCGTGG + Intronic
1185619301 X:1443670-1443692 ATGGACACACACCGCCATCGTGG + Intronic
1185619308 X:1443717-1443739 GTGGACACACACCCCCATCGTGG + Intronic
1185619318 X:1443780-1443802 GTGGACACACACCCCCATCGTGG + Intronic
1185619330 X:1443843-1443865 GAGGACACACACCACCATCGTGG + Intronic
1185619872 X:1447289-1447311 TTGGACCCATTACACCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619939 X:1447746-1447768 TTTGACACACACCACCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619956 X:1447876-1447898 TTGGACCCATAACACCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620025 X:1448350-1448372 TTGGACCCATAACACCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185620050 X:1448514-1448536 TTGGACACATGCCGCCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic