ID: 1185619206

View in Genome Browser
Species Human (GRCh38)
Location X:1443036-1443058
Sequence TTGGACGCATACCACCATCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619199_1185619206 20 Left 1185619199 X:1442993-1443015 CCATCTTGGACACACACCGCCAT No data
Right 1185619206 X:1443036-1443058 TTGGACGCATACCACCATCGTGG No data
1185619202_1185619206 1 Left 1185619202 X:1443012-1443034 CCATCTTGGAGAGACACCACCAT No data
Right 1185619206 X:1443036-1443058 TTGGACGCATACCACCATCGTGG No data
1185619201_1185619206 4 Left 1185619201 X:1443009-1443031 CCGCCATCTTGGAGAGACACCAC No data
Right 1185619206 X:1443036-1443058 TTGGACGCATACCACCATCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619206 Original CRISPR TTGGACGCATACCACCATCG TGG Intronic