ID: 1185619219

View in Genome Browser
Species Human (GRCh38)
Location X:1443131-1443153
Sequence GTGGACACACGCCGCCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 5, 2: 27, 3: 26, 4: 79}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619213_1185619219 20 Left 1185619213 X:1443088-1443110 CCATCTGGGACACACACCGTCGT 0: 2
1: 0
2: 1
3: 41
4: 113
Right 1185619219 X:1443131-1443153 GTGGACACACGCCGCCATCTTGG 0: 1
1: 5
2: 27
3: 26
4: 79
1185619215_1185619219 4 Left 1185619215 X:1443104-1443126 CCGTCGTCGTGGACACACACCGC 0: 1
1: 2
2: 4
3: 32
4: 66
Right 1185619219 X:1443131-1443153 GTGGACACACGCCGCCATCTTGG 0: 1
1: 5
2: 27
3: 26
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619219 Original CRISPR GTGGACACACGCCGCCATCT TGG Intronic
919640456 1:200040299-200040321 GCGGACACCCGCAGCCAGCTCGG + Intronic
921196234 1:212760383-212760405 GTGCACACACTCAGCCATCAAGG + Intronic
1076115089 10:127889898-127889920 GTGGACACCCACCTCCTTCTCGG - Intronic
1077918448 11:6625882-6625904 GTGGACCCAAGACCCCATCTTGG - Intronic
1081684939 11:45035823-45035845 GTGGCCAACAGCCGCCATCTCGG + Intergenic
1083812999 11:65116068-65116090 GTGGGCACATGCCCCCACCTGGG - Exonic
1083920003 11:65777481-65777503 GTGGACTCAGGCCGTTATCTTGG + Exonic
1086701818 11:89907106-89907128 GTGGACACACCCTGCGATATGGG + Intergenic
1086704350 11:89937419-89937441 GTGGACACACCCTGCGATATGGG - Intergenic
1089671703 11:120061631-120061653 GTGGGCCCAGGCCACCATCTTGG + Intergenic
1102873016 12:116428558-116428580 GAGGTCACTCGTCGCCATCTTGG - Intergenic
1111605817 13:90538088-90538110 GGAGACCCACGCTGCCATCTGGG - Intergenic
1111810311 13:93090525-93090547 GTGGACACCCCCCGCGATATGGG + Intergenic
1112216644 13:97437325-97437347 GTGGCCACAGGCTGCCATATTGG + Intronic
1112388587 13:98962434-98962456 GTGGACACACGACCCTATCAGGG - Intronic
1118214219 14:63793201-63793223 GTTGACACACACAGCCACCTTGG + Intergenic
1124553996 15:30708918-30708940 GTGGGCACCCACCCCCATCTGGG + Intronic
1124677251 15:31696753-31696775 GTGGGCACCCACCCCCATCTGGG - Intronic
1148028103 17:44602104-44602126 GTGGACACATGCAGACATCCTGG - Intergenic
1155542592 18:26884051-26884073 GTGGACACCCCCCGCCATATGGG - Intergenic
1155542615 18:26884129-26884151 CTGGACACCCTCCGCCATATGGG - Intergenic
1160507121 18:79433490-79433512 GTGCTCACCCGTCGCCATCTTGG - Intronic
1160523633 18:79522904-79522926 GGGGCCCCAGGCCGCCATCTGGG + Intronic
1160537792 18:79604199-79604221 GTGGCCTCACGCTGCCCTCTGGG - Intergenic
1165361860 19:35341707-35341729 ATGGACACACGCAGCCTCCTGGG - Exonic
1166237034 19:41464211-41464233 GTGTACACACCCCGCGATATAGG + Intergenic
1166244676 19:41517024-41517046 GTGTACACACCCCGCGATATGGG + Intergenic
1166244826 19:41517928-41517950 GTGGACACACCCTGCGATATTGG + Intergenic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
927142570 2:20140179-20140201 GTGGGCACAGGGAGCCATCTTGG - Intergenic
930946762 2:57084790-57084812 GTGGACATAGGCCTCCCTCTTGG - Intergenic
935276248 2:101477332-101477354 GTGGACATAAGCAGGCATCTTGG - Intergenic
943654064 2:190488658-190488680 AGTGACACACGCGGCCATCTGGG + Exonic
946903739 2:224396449-224396471 CTGCACACACGCCTCCATCCTGG + Intronic
946948092 2:224843105-224843127 GTGGACACTCCCCGCAATATGGG - Intronic
948388784 2:237597770-237597792 TTGGACACAGGCCTCCATCCAGG + Intronic
1176079657 20:63265874-63265896 GTGGACACATGACCCCAGCTAGG + Intronic
1183092064 22:35529183-35529205 GTGGACTTAAGCAGCCATCTTGG + Intergenic
961170323 3:124793255-124793277 ATGGACACACGCAGGCTTCTAGG + Intronic
968640652 4:1712788-1712810 GAGGAGACACGCCCCCACCTGGG - Intergenic
973205012 4:47550517-47550539 GAAGCCACACGCCACCATCTTGG - Intronic
986089799 5:4493122-4493144 GTGGACACAGGCAGGCCTCTGGG + Intergenic
987195703 5:15523804-15523826 GTGGACACGCAACTCCATCTGGG - Intronic
994391478 5:99197429-99197451 GTGGACACCCTCTGCCATATTGG + Intergenic
1002706325 5:181162801-181162823 GTGGACACACAGGGCCATCACGG + Intergenic
1003016640 6:2473371-2473393 GTGAACACAGGCAGCCATCAGGG + Intergenic
1006076392 6:31535250-31535272 TTGGGCACAAGCCGCCTTCTTGG + Intronic
1007407469 6:41643291-41643313 CTTGACACACTCAGCCATCTGGG + Intronic
1007697736 6:43744396-43744418 GTGCACACACACAGCCAACTGGG - Intergenic
1009364110 6:62844840-62844862 GTGGACACCCCCCGCGATATTGG - Intergenic
1009366367 6:62860814-62860836 GTGGACACTCCCCGCCATATGGG - Intergenic
1009366415 6:62860974-62860996 GTGGACACCCCCCGCCATATGGG - Intergenic
1009366438 6:62861055-62861077 GTGGACACCCCCCGCCATATGGG - Intergenic
1009366518 6:62861360-62861382 GTGGACACCCCCAGCCATATGGG - Intergenic
1016472907 6:144393604-144393626 CATGACACAGGCCGCCATCTTGG - Intronic
1017880602 6:158560220-158560242 GGGGACTCACGGCTCCATCTCGG - Intronic
1019490582 7:1311417-1311439 GAGGACACACGCGGGCTTCTGGG + Intergenic
1020335591 7:7059918-7059940 GTGGACACACCTCGCCATATAGG + Intergenic
1035370260 7:158375431-158375453 GTGGCCAAACCCAGCCATCTCGG + Intronic
1038574973 8:28697341-28697363 GTGGACACACGACCCAAGCTGGG + Intronic
1045926348 8:107581780-107581802 GAGGACACACTCCGCCACATCGG + Intergenic
1049503878 8:142984573-142984595 GTGGCCACACGCAGCCAGCAGGG - Intergenic
1052341543 9:27368912-27368934 GGGGACAAAGGCAGCCATCTGGG - Intronic
1059940078 9:119350160-119350182 GGGGACACACACCAGCATCTGGG + Intronic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619209 X:1443055-1443077 GTGGACACACACCGTCGTCGTGG + Intronic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619216 X:1443112-1443134 GTGGACACACACCGCCGTCGTGG + Intronic
1185619219 X:1443131-1443153 GTGGACACACGCCGCCATCTTGG + Intronic
1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG + Intronic
1185619225 X:1443169-1443191 GTGGACACACACCGCCATCGTGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619232 X:1443226-1443248 GTGCACACACACCGCCGTCGTGG + Intronic
1185619235 X:1443245-1443267 GTGGACACACGCCGCCGTCTTGG + Intronic
1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619256 X:1443378-1443400 ATGGACACACGCCGCCATCTTGG + Intronic
1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic
1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG + Intronic
1185619271 X:1443473-1443495 GTGGACACATGCCGCCATCTTGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG + Intronic
1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619289 X:1443594-1443616 TTGGACAGACACCGCCATCGTGG + Intronic
1185619292 X:1443613-1443635 GTGGACAGACACCGCCATCGTGG + Intronic
1185619295 X:1443632-1443654 GTGGACAGACACCGCCATCATGG + Intronic
1185619298 X:1443651-1443673 ATGGACACACACCGCCATCATGG + Intronic
1185619301 X:1443670-1443692 ATGGACACACACCGCCATCGTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619308 X:1443717-1443739 GTGGACACACACCCCCATCGTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619318 X:1443780-1443802 GTGGACACACACCCCCATCGTGG + Intronic
1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG + Intronic
1185619330 X:1443843-1443865 GAGGACACACACCACCATCGTGG + Intronic
1185619333 X:1443862-1443884 GTGGACAGACACCGCCGTCGTGG + Intronic
1185619336 X:1443881-1443903 GTGGACAGACACCCCCATCATGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619870 X:1447270-1447292 TTCGACACACACTGCCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619884 X:1447362-1447384 TTGGACACACATGGCCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619897 X:1447454-1447476 TTGGACACACACGGCCATGTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619912 X:1447546-1447568 TTGGACACACACGGCCATCTTGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619939 X:1447746-1447768 TTTGACACACACCACCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619948 X:1447803-1447825 TTGGACACACACAGCTATCTTGG + Intronic
1185619954 X:1447857-1447879 TGGGACACACACTGCCATCTTGG + Intronic
1185619960 X:1447895-1447917 TTGGACAAGCACCGCCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620023 X:1448331-1448353 TGGGACACACACTGCCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620050 X:1448514-1448536 TTGGACACATGCCGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1197893266 X:131286371-131286393 ATGGAGACACGCCAGCATCTTGG + Intronic