ID: 1185619222

View in Genome Browser
Species Human (GRCh38)
Location X:1443150-1443172
Sequence TTGGACACACACCGCCATCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 23, 2: 22, 3: 28, 4: 48}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619218_1185619222 1 Left 1185619218 X:1443126-1443148 CCGTCGTGGACACACGCCGCCAT 0: 1
1: 6
2: 31
3: 29
4: 66
Right 1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG 0: 1
1: 23
2: 22
3: 28
4: 48
1185619215_1185619222 23 Left 1185619215 X:1443104-1443126 CCGTCGTCGTGGACACACACCGC 0: 1
1: 2
2: 4
3: 32
4: 66
Right 1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG 0: 1
1: 23
2: 22
3: 28
4: 48
1185619217_1185619222 4 Left 1185619217 X:1443123-1443145 CCGCCGTCGTGGACACACGCCGC 0: 2
1: 0
2: 6
3: 27
4: 36
Right 1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG 0: 1
1: 23
2: 22
3: 28
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619222 Original CRISPR TTGGACACACACCGCCATCG TGG Intronic
906054072 1:42900549-42900571 CTGAACACACACCGCCACCAGGG - Intergenic
909495976 1:76279163-76279185 TTGGACACACACAGCCAGGCAGG + Intronic
915135346 1:153727943-153727965 TTGGAGACTCAGCGCCACCGCGG + Intergenic
920362543 1:205429314-205429336 TTTGAAACACACCACCAGCGTGG - Intronic
1072682319 10:97516362-97516384 TTGAACACACAGTGCCACCGTGG + Intronic
1091481647 12:838554-838576 ATGGACACACACCACCATGCTGG + Intronic
1100717571 12:97322087-97322109 TAGGACACACACAGCCCTCTTGG - Intergenic
1141883950 16:86879104-86879126 TGGGACACTCACGGCCATGGGGG + Intergenic
1144750314 17:17644065-17644087 TTGGACACACACACACATAGAGG + Intergenic
1152762241 17:82114924-82114946 TTGGCCCCACACTGCCATGGAGG + Intronic
1161698361 19:5782621-5782643 TTGGAGACACACAGCCATCAGGG - Intergenic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
933318407 2:80742337-80742359 TTGCACAAACACAGCCATGGAGG + Intergenic
936024602 2:109021694-109021716 ATGGACACACACTGCCTGCGAGG - Intergenic
940830836 2:158463567-158463589 TGGGACACACACCTGCATAGTGG - Intronic
948200277 2:236124619-236124641 TTTGACACACACCATCATAGGGG - Exonic
948388784 2:237597770-237597792 TTGGACACAGGCCTCCATCCAGG + Intronic
948606696 2:239140472-239140494 TTGGGCACACACATCCACCGTGG + Intronic
1174399911 20:50270368-50270390 TGGGACACCCACCGTCATCCAGG - Intergenic
1181980631 22:26763497-26763519 TTGGACACAGATCACCATAGAGG - Intergenic
969639232 4:8387119-8387141 TTGGACAGGAACCGCCCTCGAGG - Intronic
974990763 4:69085753-69085775 TTGGACACATACCACCAACCAGG - Intronic
984706761 4:182852878-182852900 TTGGACACAAACAGGCATAGAGG + Intergenic
991767688 5:70004957-70004979 TGGAACACTCACCGCCATCACGG + Intergenic
991846922 5:70880033-70880055 TGGAACACTCACCGCCATCACGG + Intergenic
996873444 5:128216527-128216549 TTGGCCACACACAGCAATCCGGG + Intergenic
1002437777 5:179242712-179242734 TTGGCCACACACCCCCAGAGTGG - Intronic
1002706325 5:181162801-181162823 GTGGACACACAGGGCCATCACGG + Intergenic
1011614895 6:89188839-89188861 TTGCACACACACAGACATCCTGG - Intronic
1012914587 6:105155890-105155912 TTGGCCACACATTGCCATCATGG - Intergenic
1015711469 6:136146083-136146105 TTGGTCACTCACTGCCATCAGGG + Intronic
1019307316 7:341985-342007 CTGGACACACAGCCACATCGAGG - Intergenic
1022439880 7:30424624-30424646 TTGGACACCCCCCACCATGGTGG - Exonic
1049621393 8:143599814-143599836 CTGGTCACACACCGTCATAGGGG - Exonic
1055241347 9:74190007-74190029 TTGGATAAAAACCGCCATGGTGG + Intergenic
1056805396 9:89724926-89724948 TTGGACACACACCAGCACAGAGG + Intergenic
1062000033 9:134211324-134211346 TTGGCCACACACCGTCCACGTGG - Intergenic
1062143130 9:134971284-134971306 TTGGACTCTCACCCCCATTGTGG - Intergenic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619203 X:1443017-1443039 TTGGAGAGACACCACCATCTTGG + Intronic
1185619206 X:1443036-1443058 TTGGACGCATACCACCATCGTGG + Intronic
1185619209 X:1443055-1443077 GTGGACACACACCGTCGTCGTGG + Intronic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619214 X:1443093-1443115 TGGGACACACACCGTCGTCGTGG + Intronic
1185619216 X:1443112-1443134 GTGGACACACACCGCCGTCGTGG + Intronic
1185619219 X:1443131-1443153 GTGGACACACGCCGCCATCTTGG + Intronic
1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG + Intronic
1185619225 X:1443169-1443191 GTGGACACACACCGCCATCGTGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619232 X:1443226-1443248 GTGCACACACACCGCCGTCGTGG + Intronic
1185619235 X:1443245-1443267 GTGGACACACGCCGCCGTCTTGG + Intronic
1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619256 X:1443378-1443400 ATGGACACACGCCGCCATCTTGG + Intronic
1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic
1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG + Intronic
1185619271 X:1443473-1443495 GTGGACACATGCCGCCATCTTGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG + Intronic
1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619289 X:1443594-1443616 TTGGACAGACACCGCCATCGTGG + Intronic
1185619292 X:1443613-1443635 GTGGACAGACACCGCCATCGTGG + Intronic
1185619295 X:1443632-1443654 GTGGACAGACACCGCCATCATGG + Intronic
1185619298 X:1443651-1443673 ATGGACACACACCGCCATCATGG + Intronic
1185619301 X:1443670-1443692 ATGGACACACACCGCCATCGTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619308 X:1443717-1443739 GTGGACACACACCCCCATCGTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619318 X:1443780-1443802 GTGGACACACACCCCCATCGTGG + Intronic
1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG + Intronic
1185619330 X:1443843-1443865 GAGGACACACACCACCATCGTGG + Intronic
1185619333 X:1443862-1443884 GTGGACAGACACCGCCGTCGTGG + Intronic
1185619336 X:1443881-1443903 GTGGACAGACACCCCCATCATGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619344 X:1443919-1443941 TTGGACAGACACCCCCGTCTTGG + Intronic
1185619349 X:1443938-1443960 TTGGACAGACACTGCCATGTTGG + Intronic
1185619870 X:1447270-1447292 TTCGACACACACTGCCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619884 X:1447362-1447384 TTGGACACACATGGCCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619897 X:1447454-1447476 TTGGACACACACGGCCATGTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619912 X:1447546-1447568 TTGGACACACACGGCCATCTTGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619935 X:1447708-1447730 TTGGACAAGCACTGCCATCTTGG + Intronic
1185619939 X:1447746-1447768 TTTGACACACACCACCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619948 X:1447803-1447825 TTGGACACACACAGCTATCTTGG + Intronic
1185619954 X:1447857-1447879 TGGGACACACACTGCCATCTTGG + Intronic
1185619960 X:1447895-1447917 TTGGACAAGCACCGCCATCTTGG + Intronic
1185619966 X:1447931-1447953 TTGGATACACAACACCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620023 X:1448331-1448353 TGGGACACACACTGCCATCTTGG + Intronic
1185620029 X:1448369-1448391 TTGGACAAGCACCACCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620050 X:1448514-1448536 TTGGACACATGCCGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620094 X:1448809-1448831 TTGGACAAGCACTGCCATCTTGG + Intronic
1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1198211349 X:134519247-134519269 TTGGACACAGACACCCATAGAGG - Intronic
1200203984 X:154302809-154302831 TTGGAGACACACAGACACCGTGG + Intronic