ID: 1185619222

View in Genome Browser
Species Human (GRCh38)
Location X:1443150-1443172
Sequence TTGGACACACACCGCCATCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619218_1185619222 1 Left 1185619218 X:1443126-1443148 CCGTCGTGGACACACGCCGCCAT No data
Right 1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG No data
1185619215_1185619222 23 Left 1185619215 X:1443104-1443126 CCGTCGTCGTGGACACACACCGC No data
Right 1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG No data
1185619217_1185619222 4 Left 1185619217 X:1443123-1443145 CCGCCGTCGTGGACACACGCCGC No data
Right 1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619222 Original CRISPR TTGGACACACACCGCCATCG TGG Intronic