ID: 1185619225

View in Genome Browser
Species Human (GRCh38)
Location X:1443169-1443191
Sequence GTGGACACACACCGCCATCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 7, 2: 36, 3: 18, 4: 56}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619218_1185619225 20 Left 1185619218 X:1443126-1443148 CCGTCGTGGACACACGCCGCCAT 0: 1
1: 6
2: 31
3: 29
4: 66
Right 1185619225 X:1443169-1443191 GTGGACACACACCGCCATCGTGG 0: 1
1: 7
2: 36
3: 18
4: 56
1185619217_1185619225 23 Left 1185619217 X:1443123-1443145 CCGCCGTCGTGGACACACGCCGC 0: 2
1: 0
2: 6
3: 27
4: 36
Right 1185619225 X:1443169-1443191 GTGGACACACACCGCCATCGTGG 0: 1
1: 7
2: 36
3: 18
4: 56
1185619220_1185619225 4 Left 1185619220 X:1443142-1443164 CCGCCATCTTGGACACACACCGC 0: 12
1: 16
2: 28
3: 56
4: 201
Right 1185619225 X:1443169-1443191 GTGGACACACACCGCCATCGTGG 0: 1
1: 7
2: 36
3: 18
4: 56
1185619221_1185619225 1 Left 1185619221 X:1443145-1443167 CCATCTTGGACACACACCGCCAT 0: 19
1: 27
2: 46
3: 99
4: 214
Right 1185619225 X:1443169-1443191 GTGGACACACACCGCCATCGTGG 0: 1
1: 7
2: 36
3: 18
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619225 Original CRISPR GTGGACACACACCGCCATCG TGG Intronic
900367623 1:2317719-2317741 GTGGAAACACACCGGCTTTGGGG - Intergenic
906054072 1:42900549-42900571 CTGAACACACACCGCCACCAGGG - Intergenic
918512957 1:185331293-185331315 GTGGACAGACACCTGCAGCGAGG + Intergenic
921196234 1:212760383-212760405 GTGCACACACTCAGCCATCAAGG + Intronic
1074353641 10:112762139-112762161 GTGGCCAAACACTGGCATCGCGG + Intronic
1076115089 10:127889898-127889920 GTGGACACCCACCTCCTTCTCGG - Intronic
1076868732 10:133182357-133182379 GTGGACACGCACCTGCATCCTGG - Intronic
1084519828 11:69656358-69656380 GTGTACAGACACCCCCATTGTGG - Intronic
1084519842 11:69656399-69656421 GTGTACAGACCCCCCCATCGTGG - Intronic
1091481647 12:838554-838576 ATGGACACACACCACCATGCTGG + Intronic
1103600410 12:122051047-122051069 GGAGACACACACCCCCAACGTGG - Intronic
1104448860 12:128853608-128853630 GCGGCCACACACCGGCAACGCGG + Exonic
1116114364 14:40629241-40629263 GTGTACCCACACTGCCAGCGTGG + Intergenic
1118214219 14:63793201-63793223 GTTGACACACACAGCCACCTTGG + Intergenic
1124553996 15:30708918-30708940 GTGGGCACCCACCCCCATCTGGG + Intronic
1124677251 15:31696753-31696775 GTGGGCACCCACCCCCATCTGGG - Intronic
1142397848 16:89842820-89842842 GGGGACCCACACCCCCACCGTGG + Intronic
1145007543 17:19346080-19346102 GGGGACCCACACAGCCATCCAGG - Intronic
1155542592 18:26884051-26884073 GTGGACACCCCCCGCCATATGGG - Intergenic
1161698361 19:5782621-5782643 TTGGAGACACACAGCCATCAGGG - Intergenic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
926857198 2:17270077-17270099 GTGGTAACACACAGCCATTGAGG - Intergenic
935945305 2:108280762-108280784 GTGGCCACACACCTCGATGGTGG + Intergenic
936024602 2:109021694-109021716 ATGGACACACACTGCCTGCGAGG - Intergenic
1175841431 20:62030111-62030133 GTGGCCGCACACCCCTATCGGGG - Intronic
1175908638 20:62394116-62394138 GTGGACACCCAGCGCCGTCAGGG - Intronic
1179009568 21:37545909-37545931 GTGGACCTACATCGCCATCCTGG - Intergenic
1180222368 21:46367181-46367203 GTGGAAACACACAGGCAGCGAGG - Intronic
953387733 3:42516198-42516220 GTGGGCACACACAGCCAGCCTGG + Intronic
973159075 4:46993567-46993589 GTGCACACACACGCCCACCGCGG - Exonic
987195703 5:15523804-15523826 GTGGACACGCAACTCCATCTGGG - Intronic
1002706325 5:181162801-181162823 GTGGACACACAGGGCCATCACGG + Intergenic
1007697736 6:43744396-43744418 GTGCACACACACAGCCAACTGGG - Intergenic
1009366367 6:62860814-62860836 GTGGACACTCCCCGCCATATGGG - Intergenic
1009366415 6:62860974-62860996 GTGGACACCCCCCGCCATATGGG - Intergenic
1009366438 6:62861055-62861077 GTGGACACCCCCCGCCATATGGG - Intergenic
1016688679 6:146910715-146910737 GTGGACACACAGAGACATGGAGG - Intergenic
1017269588 6:152491000-152491022 GTGGACACAAAACTCCAGCGTGG + Intronic
1019307316 7:341985-342007 CTGGACACACAGCCACATCGAGG - Intergenic
1020335591 7:7059918-7059940 GTGGACACACCTCGCCATATAGG + Intergenic
1046728968 8:117704880-117704902 GTGGGTACACACCCCCATAGTGG - Intergenic
1049621393 8:143599814-143599836 CTGGTCACACACCGTCATAGGGG - Exonic
1059940078 9:119350160-119350182 GGGGACACACACCAGCATCTGGG + Intronic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619206 X:1443036-1443058 TTGGACGCATACCACCATCGTGG + Intronic
1185619209 X:1443055-1443077 GTGGACACACACCGTCGTCGTGG + Intronic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619214 X:1443093-1443115 TGGGACACACACCGTCGTCGTGG + Intronic
1185619216 X:1443112-1443134 GTGGACACACACCGCCGTCGTGG + Intronic
1185619219 X:1443131-1443153 GTGGACACACGCCGCCATCTTGG + Intronic
1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG + Intronic
1185619225 X:1443169-1443191 GTGGACACACACCGCCATCGTGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619232 X:1443226-1443248 GTGCACACACACCGCCGTCGTGG + Intronic
1185619235 X:1443245-1443267 GTGGACACACGCCGCCGTCTTGG + Intronic
1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619256 X:1443378-1443400 ATGGACACACGCCGCCATCTTGG + Intronic
1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic
1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG + Intronic
1185619271 X:1443473-1443495 GTGGACACATGCCGCCATCTTGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG + Intronic
1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619289 X:1443594-1443616 TTGGACAGACACCGCCATCGTGG + Intronic
1185619292 X:1443613-1443635 GTGGACAGACACCGCCATCGTGG + Intronic
1185619295 X:1443632-1443654 GTGGACAGACACCGCCATCATGG + Intronic
1185619298 X:1443651-1443673 ATGGACACACACCGCCATCATGG + Intronic
1185619301 X:1443670-1443692 ATGGACACACACCGCCATCGTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619308 X:1443717-1443739 GTGGACACACACCCCCATCGTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619318 X:1443780-1443802 GTGGACACACACCCCCATCGTGG + Intronic
1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG + Intronic
1185619330 X:1443843-1443865 GAGGACACACACCACCATCGTGG + Intronic
1185619333 X:1443862-1443884 GTGGACAGACACCGCCGTCGTGG + Intronic
1185619336 X:1443881-1443903 GTGGACAGACACCCCCATCATGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619870 X:1447270-1447292 TTCGACACACACTGCCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619884 X:1447362-1447384 TTGGACACACATGGCCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619897 X:1447454-1447476 TTGGACACACACGGCCATGTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619912 X:1447546-1447568 TTGGACACACACGGCCATCTTGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619939 X:1447746-1447768 TTTGACACACACCACCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619948 X:1447803-1447825 TTGGACACACACAGCTATCTTGG + Intronic
1185619954 X:1447857-1447879 TGGGACACACACTGCCATCTTGG + Intronic
1185619960 X:1447895-1447917 TTGGACAAGCACCGCCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620023 X:1448331-1448353 TGGGACACACACTGCCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620050 X:1448514-1448536 TTGGACACATGCCGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic