ID: 1185619235

View in Genome Browser
Species Human (GRCh38)
Location X:1443245-1443267
Sequence GTGGACACACGCCGCCGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 1, 2: 5, 3: 30, 4: 46}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619230_1185619235 20 Left 1185619230 X:1443202-1443224 CCATCTGGGACACACACCGTCGT 0: 2
1: 0
2: 1
3: 41
4: 113
Right 1185619235 X:1443245-1443267 GTGGACACACGCCGCCGTCTTGG 0: 1
1: 1
2: 5
3: 30
4: 46
1185619231_1185619235 4 Left 1185619231 X:1443218-1443240 CCGTCGTCGTGCACACACACCGC 0: 1
1: 1
2: 1
3: 7
4: 85
Right 1185619235 X:1443245-1443267 GTGGACACACGCCGCCGTCTTGG 0: 1
1: 1
2: 5
3: 30
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619235 Original CRISPR GTGGACACACGCCGCCGTCT TGG Intronic
900321922 1:2088732-2088754 GTGAAGAGACGCCGCCGCCTGGG - Intronic
915253483 1:154607953-154607975 TTGGACCTTCGCCGCCGTCTGGG - Intronic
1076115089 10:127889898-127889920 GTGGACACCCACCTCCTTCTCGG - Intronic
1121367953 14:93332413-93332435 GTAAACACGCGCCCCCGTCTCGG + Intronic
1131827444 15:96332263-96332285 CTGGCCACCGGCCGCCGTCTGGG - Exonic
1142246918 16:88974403-88974425 CAGAGCACACGCCGCCGTCTGGG - Intronic
1145256139 17:21323515-21323537 GTGGACACAGGCAGCAGCCTGGG + Intergenic
1145320474 17:21764435-21764457 GTGGACACAGGCAGCAGCCTGGG - Intergenic
1153973247 18:10245545-10245567 CTGGACACACGACACAGTCTCGG - Intergenic
1155542592 18:26884051-26884073 GTGGACACCCCCCGCCATATGGG - Intergenic
1160537792 18:79604199-79604221 GTGGCCTCACGCTGCCCTCTGGG - Intergenic
1165361860 19:35341707-35341729 ATGGACACACGCAGCCTCCTGGG - Exonic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
927709678 2:25316673-25316695 GTGGACACCCGCTGCTGTGTTGG - Intronic
930946762 2:57084790-57084812 GTGGACATAGGCCTCCCTCTTGG - Intergenic
1175908638 20:62394116-62394138 GTGGACACCCAGCGCCGTCAGGG - Intronic
961170323 3:124793255-124793277 ATGGACACACGCAGGCTTCTAGG + Intronic
986089799 5:4493122-4493144 GTGGACACAGGCAGGCCTCTGGG + Intergenic
993476838 5:88376853-88376875 GTGGGCAAAGGCCACCGTCTGGG + Intergenic
1006076392 6:31535250-31535272 TTGGGCACAAGCCGCCTTCTTGG + Intronic
1009366367 6:62860814-62860836 GTGGACACTCCCCGCCATATGGG - Intergenic
1009366415 6:62860974-62860996 GTGGACACCCCCCGCCATATGGG - Intergenic
1009366438 6:62861055-62861077 GTGGACACCCCCCGCCATATGGG - Intergenic
1010378424 6:75201855-75201877 GGGGCCACACGGCGCCGTTTTGG + Intronic
1019490582 7:1311417-1311439 GAGGACACACGCGGGCTTCTGGG + Intergenic
1020335591 7:7059918-7059940 GTGGACACACCTCGCCATATAGG + Intergenic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619209 X:1443055-1443077 GTGGACACACACCGTCGTCGTGG + Intronic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619216 X:1443112-1443134 GTGGACACACACCGCCGTCGTGG + Intronic
1185619219 X:1443131-1443153 GTGGACACACGCCGCCATCTTGG + Intronic
1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG + Intronic
1185619225 X:1443169-1443191 GTGGACACACACCGCCATCGTGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619232 X:1443226-1443248 GTGCACACACACCGCCGTCGTGG + Intronic
1185619235 X:1443245-1443267 GTGGACACACGCCGCCGTCTTGG + Intronic
1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619256 X:1443378-1443400 ATGGACACACGCCGCCATCTTGG + Intronic
1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic
1185619271 X:1443473-1443495 GTGGACACATGCCGCCATCTTGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619292 X:1443613-1443635 GTGGACAGACACCGCCATCGTGG + Intronic
1185619295 X:1443632-1443654 GTGGACAGACACCGCCATCATGG + Intronic
1185619298 X:1443651-1443673 ATGGACACACACCGCCATCATGG + Intronic
1185619301 X:1443670-1443692 ATGGACACACACCGCCATCGTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619308 X:1443717-1443739 GTGGACACACACCCCCATCGTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619318 X:1443780-1443802 GTGGACACACACCCCCATCGTGG + Intronic
1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG + Intronic
1185619333 X:1443862-1443884 GTGGACAGACACCGCCGTCGTGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619344 X:1443919-1443941 TTGGACAGACACCCCCGTCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619912 X:1447546-1447568 TTGGACACACACGGCCATCTTGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620050 X:1448514-1448536 TTGGACACATGCCGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic