ID: 1185619238

View in Genome Browser
Species Human (GRCh38)
Location X:1443264-1443286
Sequence TTGGACACACACCGCCATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619234_1185619238 1 Left 1185619234 X:1443240-1443262 CCGTCGTGGACACACGCCGCCGT No data
Right 1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG No data
1185619233_1185619238 4 Left 1185619233 X:1443237-1443259 CCGCCGTCGTGGACACACGCCGC No data
Right 1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG No data
1185619231_1185619238 23 Left 1185619231 X:1443218-1443240 CCGTCGTCGTGCACACACACCGC No data
Right 1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619238 Original CRISPR TTGGACACACACCGCCATCA TGG Intronic