ID: 1185619240

View in Genome Browser
Species Human (GRCh38)
Location X:1443278-1443300
Sequence ATGGCGGTGTGTGTCCATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619240_1185619244 1 Left 1185619240 X:1443278-1443300 CCATCATGGACACACACCGCCAT No data
Right 1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG No data
1185619240_1185619247 20 Left 1185619240 X:1443278-1443300 CCATCATGGACACACACCGCCAT No data
Right 1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619240 Original CRISPR ATGGCGGTGTGTGTCCATGA TGG (reversed) Intronic