ID: 1185619241

View in Genome Browser
Species Human (GRCh38)
Location X:1443283-1443305
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 3, 1: 21, 2: 22, 3: 26, 4: 128}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619236_1185619241 4 Left 1185619236 X:1443256-1443278 CCGCCGTCTTGGACACACACCGC 0: 1
1: 12
2: 19
3: 34
4: 121
Right 1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG 0: 3
1: 21
2: 22
3: 26
4: 128
1185619237_1185619241 1 Left 1185619237 X:1443259-1443281 CCGTCTTGGACACACACCGCCAT 0: 19
1: 27
2: 46
3: 99
4: 214
Right 1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG 0: 3
1: 21
2: 22
3: 26
4: 128
1185619233_1185619241 23 Left 1185619233 X:1443237-1443259 CCGCCGTCGTGGACACACGCCGC 0: 2
1: 0
2: 6
3: 27
4: 36
Right 1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG 0: 3
1: 21
2: 22
3: 26
4: 128
1185619234_1185619241 20 Left 1185619234 X:1443240-1443262 CCGTCGTGGACACACGCCGCCGT 0: 1
1: 1
2: 7
3: 31
4: 44
Right 1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG 0: 3
1: 21
2: 22
3: 26
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900035283 1:402652-402674 ATGGCTCCACACTGCCATCTTGG + Intergenic
900056904 1:638405-638427 ATGGCTCCACACTGCCATCTTGG + Intergenic
906054072 1:42900549-42900571 CTGAACACACACCGCCACCAGGG - Intergenic
907056343 1:51372241-51372263 CTTGACACACACCGCCCACTAGG - Intronic
910057035 1:83045591-83045613 ATGGAAACACAATGGCATCTAGG + Intergenic
922257813 1:223908212-223908234 ATGGCTCCACACTGCCATCTTGG + Intergenic
924339011 1:243010991-243011013 ATGGCTCCACACTGCCATCTTGG + Intergenic
1063685486 10:8233442-8233464 CTGGGCACACATAGCCATCTAGG + Intergenic
1064467317 10:15597234-15597256 AAGGTCACACACCACCATCCTGG + Exonic
1064919559 10:20501897-20501919 ATGGACACACAACCCAAGCTAGG + Intergenic
1070399572 10:76041591-76041613 ATGGACACATCCCTCCCTCTGGG - Intronic
1072907420 10:99467297-99467319 ATGGACACAAACCTCCAGGTGGG + Intergenic
1076115089 10:127889898-127889920 GTGGACACCCACCTCCTTCTCGG - Intronic
1078832660 11:14992155-14992177 ATGTACACCCACTGCCATATTGG - Intronic
1081085299 11:38792108-38792130 AGGGACAGACAACACCATCTAGG + Intergenic
1082679630 11:56152387-56152409 ATGGTTACCCATCGCCATCTTGG - Intergenic
1084261663 11:67983065-67983087 ATGCACACCCACTGCTATCTTGG - Intergenic
1084810981 11:71611046-71611068 ATGCACACCCACTGCTATCTTGG + Intergenic
1090412561 11:126519142-126519164 ATGGCCTGACACCGCCCTCTGGG - Intronic
1091481647 12:838554-838576 ATGGACACACACCACCATGCTGG + Intronic
1094212222 12:27904662-27904684 AAGGACAGACACCCCCAACTTGG + Intergenic
1098377798 12:69836184-69836206 ATGGACCCACACCGGCATGCCGG - Intronic
1098379250 12:69851798-69851820 ACAGACACACACCACCATCTTGG + Intronic
1100717571 12:97322087-97322109 TAGGACACACACAGCCCTCTTGG - Intergenic
1103504212 12:121430330-121430352 CTGGACACTCACAGACATCTCGG + Exonic
1109409122 13:61941762-61941784 ATGCACACGCCCCGCCATATGGG + Intergenic
1111827994 13:93293122-93293144 ACAGGCACACACCACCATCTCGG + Intronic
1118132869 14:62987024-62987046 ATGTACCAACACCACCATCTTGG + Intronic
1118214219 14:63793201-63793223 GTTGACACACACAGCCACCTTGG + Intergenic
1122481833 14:102052273-102052295 ACAGACACACACCACCATGTCGG + Intergenic
1124553996 15:30708918-30708940 GTGGGCACCCACCCCCATCTGGG + Intronic
1124677251 15:31696753-31696775 GTGGGCACCCACCCCCATCTGGG - Intronic
1125550564 15:40541472-40541494 ATGGGCACACACCACCAACCCGG + Intronic
1129702811 15:77777402-77777424 ATGGACACACACACACAACTGGG + Intronic
1136551462 16:30984557-30984579 AGGGACCCACCCCGCCATCCTGG - Exonic
1139298644 16:65925152-65925174 ATGGACACATACTGCAATTTGGG + Intergenic
1141133881 16:81453337-81453359 ATGGAATCAAACAGCCATCTGGG + Intronic
1143024396 17:3932903-3932925 AGGGACACACACCTCCCACTCGG + Intronic
1143196561 17:5080268-5080290 ATGGACATCCACCTTCATCTGGG - Intronic
1144495240 17:15741601-15741623 ATGGGCAGACACTTCCATCTTGG - Intronic
1144638992 17:16927296-16927318 ATGGGCAGACATTGCCATCTTGG + Intergenic
1146122535 17:30208173-30208195 AGAGACACACACCCCCTTCTTGG + Intronic
1148760568 17:49997746-49997768 ATGGACCCACTCTGGCATCTTGG - Intergenic
1149552610 17:57551449-57551471 AGGCACACAGACCGCCGTCTGGG + Intronic
1149948715 17:60960819-60960841 CTGCAGAAACACCGCCATCTTGG - Intronic
1155542592 18:26884051-26884073 GTGGACACCCCCCGCCATATGGG - Intergenic
1155542615 18:26884129-26884151 CTGGACACCCTCCGCCATATGGG - Intergenic
1160016436 18:75144390-75144412 ATGAACACACACCCCCATGTAGG - Intergenic
1161698361 19:5782621-5782643 TTGGAGACACACAGCCATCAGGG - Intergenic
1165121617 19:33562672-33562694 ATGGACTCACAACGCCCTCCTGG - Intergenic
1165361860 19:35341707-35341729 ATGGACACACGCAGCCTCCTGGG - Exonic
1167633864 19:50642117-50642139 ATGTAAACACACATCCATCTGGG - Intronic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
932653139 2:73581689-73581711 AGGGACACACAACTCCACCTGGG - Intronic
932707545 2:74038356-74038378 ATGGGAACACACCTCCAACTTGG + Intronic
936024602 2:109021694-109021716 ATGGACACACACTGCCTGCGAGG - Intergenic
937477181 2:122226135-122226157 AGGGACACACACCACTCTCTCGG + Intergenic
939003699 2:136763623-136763645 CTGCACACACACCCCCATATGGG - Intergenic
939422957 2:141997372-141997394 ATGTACACACACACACATCTTGG - Intronic
939907966 2:147941753-147941775 ATACACACACATCTCCATCTGGG - Intronic
943654064 2:190488658-190488680 AGTGACACACGCGGCCATCTGGG + Exonic
945230843 2:207587831-207587853 ATGGACACAAACTTACATCTAGG + Intronic
946500581 2:220243090-220243112 ATGGACACACTGCCCCACCTGGG - Intergenic
1169134041 20:3185650-3185672 AAGGATACACAAGGCCATCTAGG + Intergenic
1170702785 20:18718699-18718721 ATGCACACACACACCCCTCTAGG + Intronic
1175661067 20:60812947-60812969 ATGTACACACAGCTCTATCTTGG - Intergenic
1180720824 22:17907157-17907179 AGGGAGACACAAGGCCATCTCGG + Intronic
1181339502 22:22166507-22166529 AGGGACACACACAGCAATCCTGG - Intergenic
1181867600 22:25871293-25871315 ATGGATCCCCACAGCCATCTTGG - Intronic
949882505 3:8672820-8672842 ATGCACACCCACTGCTATCTTGG + Intronic
950073969 3:10174077-10174099 ATCCACACACACTCCCATCTTGG - Intronic
957076735 3:75608645-75608667 ATGCACACCCACTGCTATCTTGG - Intergenic
960028576 3:113035382-113035404 ATGCACACACACAAACATCTTGG - Intergenic
961170323 3:124793255-124793277 ATGGACACACGCAGGCTTCTAGG + Intronic
965779697 3:172271866-172271888 AAGGATAGACACTGCCATCTTGG + Intronic
969020188 4:4134940-4134962 ATGCACACCCACTGCTATCTTGG - Intergenic
969733670 4:8972473-8972495 ATGCACACCCACGGCTATCTTGG + Intergenic
973966259 4:56165028-56165050 ATGGCCAGAAACTGCCATCTGGG - Intergenic
979238110 4:118424247-118424269 ATGGCTCCACACTGCCATCTTGG - Intergenic
980548340 4:134299594-134299616 ATTGACAAACACAGACATCTGGG - Intergenic
987195703 5:15523804-15523826 GTGGACACGCAACTCCATCTGGG - Intronic
988702475 5:33689095-33689117 ATAGACACTAACAGCCATCTGGG + Intronic
997661898 5:135595403-135595425 ATGGACAGGCACCGCCAACCAGG + Intergenic
997682515 5:135766226-135766248 ATGTACACCCACCGCGATATGGG - Intergenic
1000064398 5:157682600-157682622 AGGGACACACACAGCCTTCCAGG - Intergenic
1002261161 5:177994971-177994993 CTGGACACACACGACCACCTGGG + Intronic
1002706325 5:181162801-181162823 GTGGACACACAGGGCCATCACGG + Intergenic
1002738536 5:181416219-181416241 ATGGCTCCACACTGCCATCTTGG - Intergenic
1007407469 6:41643291-41643313 CTTGACACACTCAGCCATCTGGG + Intronic
1007697736 6:43744396-43744418 GTGCACACACACAGCCAACTGGG - Intergenic
1009366367 6:62860814-62860836 GTGGACACTCCCCGCCATATGGG - Intergenic
1009366415 6:62860974-62860996 GTGGACACCCCCCGCCATATGGG - Intergenic
1009366438 6:62861055-62861077 GTGGACACCCCCCGCCATATGGG - Intergenic
1010625296 6:78131248-78131270 ATGGAAACACACTGCCATGAAGG + Intergenic
1014923896 6:127247689-127247711 ATGGACAGTCACGGCCAGCTGGG + Intergenic
1019243639 6:170691771-170691793 ATGGCTCCACACTGCCATCTTGG - Intergenic
1020307601 7:6846969-6846991 ATGCACACCCACTGCTATCTTGG - Intergenic
1020335591 7:7059918-7059940 GTGGACACACCTCGCCATATAGG + Intergenic
1020335738 7:7060887-7060909 ATGTACACCCACCGCTATATTGG + Intergenic
1022842276 7:34176085-34176107 ATGGACACACATAGACATCAGGG - Intergenic
1023382290 7:39621791-39621813 ATGGACACATATCACCATATTGG + Intergenic
1029078719 7:97955913-97955935 ATGCACACCCACTGCTATCTTGG - Intergenic
1035504483 8:116389-116411 ATGGCTCCACACTGCCATCTTGG + Intergenic
1038129105 8:24709192-24709214 ATGGACACTAACCACCAGCTAGG + Intergenic
1041087716 8:54272015-54272037 ATGGACAACAACCTCCATCTCGG + Intergenic
1043548977 8:81347407-81347429 ATGGACACACACAGACACATTGG + Intergenic
1049270193 8:141691458-141691480 ATGGCCACCCACGGCCAACTGGG - Intergenic
1049529773 8:143148396-143148418 ATGGGCACCCACCCCCATCATGG + Intergenic
1050902304 9:10963792-10963814 ATGTACACCCCCTGCCATCTTGG + Intergenic
1051295362 9:15589184-15589206 ATTGACACACATAGCCACCTTGG + Intronic
1058375184 9:104314717-104314739 ATGGACAAAGACCCCCAACTCGG + Intergenic
1059940078 9:119350160-119350182 GGGGACACACACCAGCATCTGGG + Intronic
1061398562 9:130356234-130356256 ATGCACAGACACCTCCACCTCGG - Intronic
1203603828 Un_KI270748v1:40994-41016 ATGGCTCCACACTGCCATCTTGG - Intergenic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619203 X:1443017-1443039 TTGGAGAGACACCACCATCTTGG + Intronic
1185619209 X:1443055-1443077 GTGGACACACACCGTCGTCGTGG + Intronic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619216 X:1443112-1443134 GTGGACACACACCGCCGTCGTGG + Intronic
1185619219 X:1443131-1443153 GTGGACACACGCCGCCATCTTGG + Intronic
1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG + Intronic
1185619225 X:1443169-1443191 GTGGACACACACCGCCATCGTGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619232 X:1443226-1443248 GTGCACACACACCGCCGTCGTGG + Intronic
1185619235 X:1443245-1443267 GTGGACACACGCCGCCGTCTTGG + Intronic
1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619256 X:1443378-1443400 ATGGACACACGCCGCCATCTTGG + Intronic
1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic
1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG + Intronic
1185619271 X:1443473-1443495 GTGGACACATGCCGCCATCTTGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG + Intronic
1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619289 X:1443594-1443616 TTGGACAGACACCGCCATCGTGG + Intronic
1185619292 X:1443613-1443635 GTGGACAGACACCGCCATCGTGG + Intronic
1185619295 X:1443632-1443654 GTGGACAGACACCGCCATCATGG + Intronic
1185619298 X:1443651-1443673 ATGGACACACACCGCCATCATGG + Intronic
1185619301 X:1443670-1443692 ATGGACACACACCGCCATCGTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619308 X:1443717-1443739 GTGGACACACACCCCCATCGTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619318 X:1443780-1443802 GTGGACACACACCCCCATCGTGG + Intronic
1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG + Intronic
1185619330 X:1443843-1443865 GAGGACACACACCACCATCGTGG + Intronic
1185619333 X:1443862-1443884 GTGGACAGACACCGCCGTCGTGG + Intronic
1185619336 X:1443881-1443903 GTGGACAGACACCCCCATCATGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619344 X:1443919-1443941 TTGGACAGACACCCCCGTCTTGG + Intronic
1185619349 X:1443938-1443960 TTGGACAGACACTGCCATGTTGG + Intronic
1185619870 X:1447270-1447292 TTCGACACACACTGCCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619884 X:1447362-1447384 TTGGACACACATGGCCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619897 X:1447454-1447476 TTGGACACACACGGCCATGTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619912 X:1447546-1447568 TTGGACACACACGGCCATCTTGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619935 X:1447708-1447730 TTGGACAAGCACTGCCATCTTGG + Intronic
1185619939 X:1447746-1447768 TTTGACACACACCACCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619948 X:1447803-1447825 TTGGACACACACAGCTATCTTGG + Intronic
1185619954 X:1447857-1447879 TGGGACACACACTGCCATCTTGG + Intronic
1185619960 X:1447895-1447917 TTGGACAAGCACCGCCATCTTGG + Intronic
1185619966 X:1447931-1447953 TTGGATACACAACACCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620023 X:1448331-1448353 TGGGACACACACTGCCATCTTGG + Intronic
1185620029 X:1448369-1448391 TTGGACAAGCACCACCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620050 X:1448514-1448536 TTGGACACATGCCGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620094 X:1448809-1448831 TTGGACAAGCACTGCCATCTTGG + Intronic
1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1190107464 X:47570463-47570485 ATGGACACCCACAGTCACCTAGG + Intronic
1191692222 X:63952387-63952409 CTGAACACACACCCCCAACTGGG + Intergenic
1193873379 X:86829841-86829863 AGGGACACACACTGACATTTGGG - Intronic
1197893266 X:131286371-131286393 ATGGAGACACGCCAGCATCTTGG + Intronic
1202385888 Y:24326039-24326061 ATGGCTCCACACTGCCATCTTGG - Intergenic
1202484898 Y:25344089-25344111 ATGGCTCCACACTGCCATCTTGG + Intergenic