ID: 1185619242

View in Genome Browser
Species Human (GRCh38)
Location X:1443294-1443316
Sequence GCGGTGTGTGTCCAAGATGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619242_1185619250 23 Left 1185619242 X:1443294-1443316 CCGCCATCTTGGACACACACCGC No data
Right 1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG No data
1185619242_1185619247 4 Left 1185619242 X:1443294-1443316 CCGCCATCTTGGACACACACCGC No data
Right 1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619242 Original CRISPR GCGGTGTGTGTCCAAGATGG CGG (reversed) Intronic