ID: 1185619243

View in Genome Browser
Species Human (GRCh38)
Location X:1443297-1443319
Sequence ATGGCGGTGTGTGTCCAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619243_1185619247 1 Left 1185619243 X:1443297-1443319 CCATCTTGGACACACACCGCCAT No data
Right 1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG No data
1185619243_1185619250 20 Left 1185619243 X:1443297-1443319 CCATCTTGGACACACACCGCCAT No data
Right 1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619243 Original CRISPR ATGGCGGTGTGTGTCCAAGA TGG (reversed) Intronic