ID: 1185619246

View in Genome Browser
Species Human (GRCh38)
Location X:1443316-1443338
Sequence ATGGCGGTGTGTGTCCAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619246_1185619253 20 Left 1185619246 X:1443316-1443338 CCATCTTGGACACACACCGCCAT No data
Right 1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG No data
1185619246_1185619250 1 Left 1185619246 X:1443316-1443338 CCATCTTGGACACACACCGCCAT No data
Right 1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619246 Original CRISPR ATGGCGGTGTGTGTCCAAGA TGG (reversed) Intronic