ID: 1185619247

View in Genome Browser
Species Human (GRCh38)
Location X:1443321-1443343
Sequence TTGGACACACACCGCCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619242_1185619247 4 Left 1185619242 X:1443294-1443316 CCGCCATCTTGGACACACACCGC No data
Right 1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG No data
1185619243_1185619247 1 Left 1185619243 X:1443297-1443319 CCATCTTGGACACACACCGCCAT No data
Right 1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG No data
1185619239_1185619247 23 Left 1185619239 X:1443275-1443297 CCGCCATCATGGACACACACCGC No data
Right 1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG No data
1185619240_1185619247 20 Left 1185619240 X:1443278-1443300 CCATCATGGACACACACCGCCAT No data
Right 1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619247 Original CRISPR TTGGACACACACCGCCATCT TGG Intronic