ID: 1185619248

View in Genome Browser
Species Human (GRCh38)
Location X:1443332-1443354
Sequence GCGGTGTCTGTCCAAGATGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619248_1185619256 23 Left 1185619248 X:1443332-1443354 CCGCCATCTTGGACAGACACCGC No data
Right 1185619256 X:1443378-1443400 ATGGACACACGCCGCCATCTTGG No data
1185619248_1185619253 4 Left 1185619248 X:1443332-1443354 CCGCCATCTTGGACAGACACCGC No data
Right 1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619248 Original CRISPR GCGGTGTCTGTCCAAGATGG CGG (reversed) Intronic