ID: 1185619251

View in Genome Browser
Species Human (GRCh38)
Location X:1443351-1443373
Sequence GTGGTGTGTGTCCAAGATGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 2, 1: 24, 2: 37, 3: 58, 4: 256}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619251_1185619259 23 Left 1185619251 X:1443351-1443373 CCGCCATCTTGGACACACACCAC 0: 2
1: 24
2: 37
3: 58
4: 256
Right 1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG 0: 1
1: 20
2: 20
3: 25
4: 51
1185619251_1185619256 4 Left 1185619251 X:1443351-1443373 CCGCCATCTTGGACACACACCAC 0: 2
1: 24
2: 37
3: 58
4: 256
Right 1185619256 X:1443378-1443400 ATGGACACACGCCGCCATCTTGG 0: 1
1: 5
2: 23
3: 24
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619251 Original CRISPR GTGGTGTGTGTCCAAGATGG CGG (reversed) Intronic
902322345 1:15676946-15676968 GTGGTGTTTGTCCAAGACAACGG - Intergenic
902963623 1:19981955-19981977 GTGGTGTTTGTCCGAGATGACGG - Intergenic
904041655 1:27588856-27588878 GCCGTGTGTGTACATGATGGAGG + Intronic
904048141 1:27621760-27621782 GTGGGGGGTGTCCAAGATGAGGG - Intronic
904300892 1:29554343-29554365 GTGTTGTGTGTCTATGATGTGGG + Intergenic
904325111 1:29723269-29723291 GTGGTGTGTGACGGTGATGGTGG - Intergenic
904824714 1:33266733-33266755 GTGGTATGGCTCCCAGATGGAGG + Intronic
907444301 1:54498278-54498300 GTGGTGTGTGTCCAACAGGCTGG + Intergenic
908015536 1:59829860-59829882 GTGGGATGTGGCTAAGATGGTGG - Intronic
910365543 1:86461172-86461194 GTGGAGAGTGACCCAGATGGTGG + Intergenic
910871262 1:91835222-91835244 ATGGTGTGTGTCAAAGTTGAGGG - Intronic
912490436 1:110059801-110059823 CTGGTCTGTGTCCAGGATGCAGG - Intronic
912799761 1:112713667-112713689 ACGGTGTGTGTCTAAGGTGGGGG - Intronic
915079702 1:153343721-153343743 GTGGTGTTTGTCTGAGATGATGG - Intronic
915801414 1:158796969-158796991 GTGCTGCCTGTCCAGGATGGGGG + Intergenic
916111154 1:161459216-161459238 GTGGCGTGAGACCAAGGTGGGGG - Intergenic
916327842 1:163582892-163582914 GTGGTGTTTGTCCCAGTTGTTGG + Intergenic
916553548 1:165873337-165873359 GTAGCTTGTGTCCAAGACGGTGG - Intronic
916568869 1:166008035-166008057 GTGCTGTGGGCCCAAGCTGGGGG + Intergenic
916868457 1:168886880-168886902 TTTTTGTTTGTCCAAGATGGTGG + Intergenic
917273404 1:173303523-173303545 GCGGTGTTTGTCCGAGATGACGG + Intergenic
917444191 1:175092929-175092951 GTGGTGTATATGCAAGATGGTGG - Intronic
918654476 1:187007068-187007090 GTGGTGTTTGTCCAAGATGACGG + Intergenic
918658141 1:187054356-187054378 GTGGTGTTTGTCCAAGATGACGG + Intergenic
919479486 1:198069874-198069896 GTTATATGTGTCCAAAATGGGGG - Intergenic
919857265 1:201714381-201714403 GGGCTGAGTGTCCAAGATGCGGG - Intronic
920281218 1:204845199-204845221 GCGGTGTATGTCCGAGATGATGG + Intronic
920610208 1:207428526-207428548 GCAGTGTTTGTCCAAGATGATGG + Intergenic
920925481 1:210337580-210337602 GTGGTGTGCTTGGAAGATGGAGG - Intronic
920951432 1:210575029-210575051 GAGGTGTATGTCCAAGATGGTGG + Intronic
921261077 1:213385602-213385624 GTCCTGTGTGTCCAAGAAGCTGG + Intergenic
922594033 1:226799837-226799859 GAGGTCTGTGTCCAAGGTTGTGG + Intergenic
922607073 1:226896167-226896189 GTGCTGTGAGCCCAGGATGGAGG + Intergenic
922703625 1:227777271-227777293 GTGGTGCGTGCCCAAGATACTGG - Intronic
1063332021 10:5169239-5169261 GTAGTGTTTGTCCGAGATGATGG + Intergenic
1064802022 10:19087158-19087180 GTGGTGTTTGTCCAAGATGATGG + Intronic
1064889210 10:20150029-20150051 GTGGGGTATGTCGATGATGGGGG - Intronic
1066056507 10:31686013-31686035 ATATTGTGTGCCCAAGATGGAGG - Intergenic
1066246793 10:33591644-33591666 GTGGGCCGTTTCCAAGATGGTGG + Intergenic
1067825926 10:49572833-49572855 GTGCTGTGTGTCCAGGCTGTGGG - Intergenic
1068792017 10:61039197-61039219 GTGGGCTGCTTCCAAGATGGTGG + Intergenic
1068918434 10:62458456-62458478 TGTGTGTGTGTTCAAGATGGTGG - Intronic
1071509730 10:86253926-86253948 GTGCTGCCTGTCCCAGATGGAGG - Intronic
1073991198 10:109264031-109264053 ATGGTGCTTGTCCAAGATGGCGG - Intergenic
1074254025 10:111782484-111782506 AAGGAGTGTGTCCAAGATGAAGG + Intergenic
1076035803 10:127197245-127197267 GTGGTGTGTGCTCTGGATGGGGG - Intronic
1076184903 10:128438642-128438664 GTAGTGTGTGTGCACGATGTAGG + Intergenic
1077417012 11:2428776-2428798 GTGGTGGGTGACGAAGGTGGTGG + Intergenic
1078993308 11:16670638-16670660 GTGCTGTGGGCCCAAGTTGGGGG - Intronic
1080250526 11:30228432-30228454 GTGGTGAGTGTACATGGTGGTGG - Intergenic
1082850934 11:57764213-57764235 GTGGTCTGTGTTCCAGATTGCGG + Intronic
1083149217 11:60781379-60781401 GTGGTGTGGTTCAAAGATGCAGG - Intergenic
1083181303 11:60987575-60987597 GTGGTGTGTGTGTATGGTGGGGG + Intronic
1086332633 11:85769369-85769391 GTGATGTGTTTTGAAGATGGAGG + Intronic
1086836472 11:91630422-91630444 GTGCTGTGTGACCAAGATGGAGG - Intergenic
1088110146 11:106251453-106251475 GTGGGCTGCTTCCAAGATGGTGG - Intergenic
1088730035 11:112672001-112672023 GTGCTGTGGGCCCAAGCTGGGGG - Intergenic
1089595660 11:119578017-119578039 CTGCTGTGTCTCCAAGAGGGAGG + Intergenic
1090135160 11:124190354-124190376 GTGGTGTTTGTCCAAGATGACGG - Intergenic
1094125401 12:27017711-27017733 GCGGTGTTTGTCCGAGATGACGG + Intergenic
1094203906 12:27820196-27820218 GTGGTGTTTGTCTGAGATGACGG + Intergenic
1095419787 12:42013066-42013088 GAGGTGTGTCTCCCAGAGGGAGG - Intergenic
1095719149 12:45381484-45381506 ATGCTGTGTGTCCCAGATTGAGG - Intronic
1098140807 12:67448563-67448585 GAGGTGTGTATACAAGGTGGAGG - Intergenic
1099487512 12:83246633-83246655 GTGGTGTTCGTCCAATATGATGG + Intergenic
1099589974 12:84574991-84575013 TTGGTGTTTGTCCCAGATGACGG - Intergenic
1100287151 12:93177795-93177817 GCGATGTTTGTCCAAGATGACGG - Intergenic
1100366490 12:93925922-93925944 GTGGTGTTTGTCTGAGATGATGG - Intergenic
1101341626 12:103847274-103847296 GTTGTGTGTGGCCAAGAGAGAGG - Intergenic
1101809705 12:108096982-108097004 GTGGTCTCTATCCAAGATAGGGG - Intergenic
1102172860 12:110855295-110855317 GTGGTGTGTTTTCAAGCTGGTGG + Intronic
1102826601 12:115952294-115952316 GTGGGGTGTGTTCCAGGTGGAGG - Intergenic
1103606954 12:122094002-122094024 GTGGTGTGTGTGCAGGGTGTGGG + Intronic
1104850905 12:131873244-131873266 GTGGGCTGTTTCCAAGATGACGG + Intergenic
1105014832 12:132780174-132780196 GTGGTGTGTGTGCACGCGGGGGG - Intronic
1105444560 13:20441380-20441402 GAGGTGTGTGTCCAAAGCGGGGG + Intronic
1105702029 13:22940932-22940954 TTTGTGTGTGTCCAGGACGGTGG - Intergenic
1105854648 13:24362717-24362739 TTTGTGTGTGTCCAGGATGGTGG - Intergenic
1108268631 13:48736803-48736825 GTGTAATGTGTCCAAGATTGGGG + Intergenic
1108954082 13:56129335-56129357 GTGGTGTATGTCCCAGCTAGAGG - Intergenic
1109523538 13:63544825-63544847 GTGGGCCGCGTCCAAGATGGTGG + Intergenic
1110986533 13:81977704-81977726 GTGATGTTTGTCCAAGATGATGG - Intergenic
1112228881 13:97568146-97568168 GTGGTGTGTGTCCTGGAATGTGG - Intergenic
1112228986 13:97568955-97568977 GTGGTGTGTGTCCTGGAATGTGG + Intergenic
1112566818 13:100558977-100558999 GTGGTGGGTGTGGAGGATGGAGG + Intronic
1113226962 13:108169438-108169460 GTGCTGTGGGCCCAAGCTGGGGG - Intergenic
1113896025 13:113764970-113764992 GTGCAGTGGGTCCAAGACGGGGG + Intronic
1117485275 14:56190559-56190581 GTGGTGTTTGGTCAGGATGGGGG - Intronic
1118125353 14:62896373-62896395 GGGGAGTGAGTACAAGATGGAGG + Intronic
1118329405 14:64803877-64803899 TTGGTGTTTGGCCAAGAGGGTGG - Intronic
1120046839 14:79817677-79817699 GTGATGGGTGTCCACGCTGGGGG - Intronic
1120163064 14:81166126-81166148 TAGGTGTGTGTCCAGGATGTAGG - Intergenic
1120904545 14:89608985-89609007 GTGGTGACTGTACAACATGGAGG + Intronic
1121656198 14:95597657-95597679 GTGGTGTTTGTCCGAGATGAAGG + Intergenic
1121915361 14:97832995-97833017 GTGGTGTGAGCCCCAGAGGGGGG + Intergenic
1122592084 14:102860960-102860982 GTGGTCTTTGGGCAAGATGGTGG + Intronic
1125750704 15:42025760-42025782 GTGGTGTTTGTCTGAGATGACGG + Intronic
1129245715 15:74277583-74277605 CTGATGTGTGTGCAGGATGGGGG - Intronic
1129584572 15:76849442-76849464 GTGCTGTGGGCCCAAGCTGGGGG - Intronic
1129594974 15:76955999-76956021 GTCAGGTGTGTCCAAGACGGTGG + Intergenic
1130956042 15:88628235-88628257 GTGGTGAGTGACCAGCATGGTGG + Intronic
1135619746 16:23945486-23945508 GTTGTGTGTGTCCACGATAGGGG + Intronic
1135773174 16:25233277-25233299 TAGATGTGTGTCCAAGATCGTGG - Intergenic
1137365244 16:47854242-47854264 GTTGTGTGTGTGCACGTTGGAGG - Intergenic
1137426353 16:48384778-48384800 GGGGTGTGCGGCCAACATGGCGG - Intronic
1137721072 16:50627832-50627854 CTGGTGTGTGATCAGGATGGGGG - Intronic
1138599473 16:58046257-58046279 GTGGTGTGAGTCGGAGAGGGAGG - Exonic
1138967565 16:62103468-62103490 GCGGTGTTTGTCCAAGATGATGG + Intergenic
1139323911 16:66136902-66136924 GTGCTATGTATCCACGATGGTGG - Intergenic
1139464400 16:67146570-67146592 GTGGTCTGTGTCCAACAAGATGG + Intronic
1139669837 16:68485212-68485234 GTGGTATGTGTCCATCCTGGAGG + Intergenic
1139915956 16:70428600-70428622 CTGGATTGTGTCCAAGAGGGAGG - Intronic
1141191899 16:81831118-81831140 ATGGTGTGTGACCAGGAGGGAGG - Intronic
1141266117 16:82498765-82498787 GTGGTCTGTGTCCAGGTTTGGGG + Intergenic
1142921400 17:3190280-3190302 GTGGAGTTTGTCCGAGATGAGGG + Intergenic
1145082257 17:19903585-19903607 CTGGTGTGTGGGCAAGAGGGAGG + Intergenic
1147519263 17:41153851-41153873 GCAGTGTTTGTCCAAGATGATGG - Intergenic
1148815727 17:50326593-50326615 TTGGTGTGAGCCTAAGATGGGGG - Intergenic
1152228311 17:79102709-79102731 GTGGAGTGGGGCCAAGGTGGGGG + Intronic
1152665890 17:81569300-81569322 GTAGTTTGTCTCCAGGATGGCGG - Intronic
1157259388 18:46165419-46165441 GTGGGCTGCTTCCAAGATGGCGG - Intergenic
1157303750 18:46500962-46500984 ATGATGTGTGTCTAAAATGGAGG - Intronic
1157557501 18:48622287-48622309 GTGGCGTGTGTCCAGGAGTGGGG + Intronic
1158275080 18:55758286-55758308 GTGGTGTCTGTCCAAGAGGGAGG + Intergenic
1159456433 18:68665066-68665088 GTCTTGTGTGGCCAGGATGGAGG + Intergenic
1160102722 18:75938225-75938247 GTGGGCTGCTTCCAAGATGGTGG + Intergenic
1160292259 18:77605892-77605914 GTGATGTTTGTTCAAGATGATGG + Intergenic
1160415022 18:78703725-78703747 GTGGTGTGTGTGTGAGTTGGGGG + Intergenic
1162822274 19:13230129-13230151 GTGGTGGGGGCCCAGGATGGAGG + Exonic
1163073434 19:14865960-14865982 GTGGCGGTTGTCCAAGATGATGG - Intergenic
1163086950 19:14988386-14988408 GCTGTGTTTGTCCAAGATGATGG + Intronic
1163188557 19:15658640-15658662 GTGGTGTGTGTCTTGGAGGGAGG - Intronic
1166734414 19:45075889-45075911 GTGGGGTGGGGCCAGGATGGGGG + Intronic
1166888643 19:45976288-45976310 GTTGTGTGTGTCCAAACGGGAGG - Intergenic
1168420922 19:56202840-56202862 GTGGTGTGTGGCCAGCAAGGTGG - Intronic
925600433 2:5603503-5603525 GCGCTGTCTGTCCAGGATGGTGG - Intergenic
925607849 2:5677011-5677033 GTCGTGTTTGTCTAAGATGGAGG + Intergenic
925726784 2:6880734-6880756 GTGGTGTTTGTCTGAGATGATGG + Intronic
926141759 2:10372248-10372270 GTGCTGTGTGGCTAAGGTGGGGG + Intronic
926635447 2:15174265-15174287 GTGGCCAGTGTCCAAGCTGGGGG - Intronic
927007844 2:18868784-18868806 GTGGTGTGTGTTGGAGGTGGGGG - Intergenic
930599214 2:53424456-53424478 GCGGTGTTTGTCCAAGATGACGG + Intergenic
931838790 2:66127647-66127669 GAGGTGTGTGTCCAAGTGTGCGG + Intergenic
932918233 2:75879412-75879434 GTGGGCTGCTTCCAAGATGGTGG - Intergenic
933108017 2:78357869-78357891 GTGTTGTGTGTGCATGTTGGGGG + Intergenic
935050820 2:99523539-99523561 GTGGTGTTTGTCCAAGGTGACGG + Intergenic
936387685 2:112044528-112044550 GTGGGCTGCTTCCAAGATGGTGG + Intergenic
936723706 2:115286628-115286650 GGGGTGTGTGTCGAGGAAGGAGG + Intronic
939391178 2:141571019-141571041 GGGGTGTGTCTCCAAGCTGGAGG - Intronic
943645576 2:190405945-190405967 GTGGTGTGCTTTGAAGATGGAGG + Intergenic
944591282 2:201220179-201220201 GCGGTGTTTGTCTAAGATGACGG - Exonic
945326834 2:208491938-208491960 GTGGTGTTTATCCAAGATGATGG + Intronic
945694810 2:213089308-213089330 GTGATTTGTGTGAAAGATGGTGG - Intronic
947001093 2:225457043-225457065 GCGGTATTTGTCCAAGATGATGG + Intronic
947463439 2:230322384-230322406 GTGGTGTTTGTCCAAGATGATGG - Intergenic
948022739 2:234749652-234749674 GTGGTGTTTGTCCACATTGGAGG - Intergenic
948345626 2:237295224-237295246 TTGGTGTGTGTCCAAAGTAGAGG + Intergenic
948592701 2:239061588-239061610 GGTGTGTGTGTACAAGAGGGTGG + Intronic
948745299 2:240087821-240087843 GCGGTGTTTGTCCAAGATGACGG + Intergenic
1170177683 20:13490688-13490710 GGGGTGTGTGTGTAAGAGGGTGG - Intronic
1172883566 20:38217086-38217108 GTGGTGTCTGTGCAAGTGGGTGG + Intronic
1173163230 20:40667922-40667944 GTGGTGTGTGTGCATGTGGGGGG + Intergenic
1174412364 20:50344298-50344320 ATGGTGGGTGCCCAAGCTGGGGG + Intergenic
1177331994 21:19677223-19677245 GTGGGCTGCTTCCAAGATGGTGG + Intergenic
1179300883 21:40109431-40109453 GTGGTGTGGAGCCAAGATGGCGG + Intronic
1179431322 21:41323127-41323149 GTGGTTTCTGTCCCAGCTGGAGG + Intronic
1180017983 21:45099873-45099895 TTGGTGTGTGTGCAACTTGGTGG + Intronic
1180043363 21:45291806-45291828 GTGCTGTGGGTCCCCGATGGGGG - Intergenic
1180744587 22:18078726-18078748 GTGGTTTGTCTCCGAGAGGGTGG + Intronic
1181283996 22:21739199-21739221 GTGGTGCGTTTCCCAGTTGGGGG - Intergenic
1181902851 22:26169878-26169900 GTGGTGGCTGTCCAAAATCGGGG + Intronic
1184301832 22:43565536-43565558 TTGGTGAGTATCCAAGATGGCGG + Intronic
1185189748 22:49427683-49427705 GTGGTGTGGGCCCAAGTAGGGGG - Intronic
949254337 3:2027667-2027689 GTGCGGTGTGTCAAAGGTGGAGG - Intergenic
949653866 3:6193816-6193838 GTGGTGGTTGTCCAAGATGAAGG - Intergenic
953042575 3:39268097-39268119 GTGGTGTCTCACCAAGATGAGGG + Intronic
954628599 3:52036185-52036207 GTGGAGTGTGCCCCAGCTGGAGG - Intergenic
955601778 3:60653082-60653104 GTGGTGTGTGTGAAAGAATGAGG - Intronic
956334311 3:68146210-68146232 GTTGAGTGGGTCTAAGATGGGGG + Intronic
956805702 3:72808975-72808997 GTGGTGTGGGTGCAGGAAGGAGG + Intronic
958002683 3:87771588-87771610 GTGCTCTGCTTCCAAGATGGGGG + Intergenic
960884781 3:122383218-122383240 CTCGTGTTTGTCCAATATGGCGG - Exonic
961796577 3:129413230-129413252 GCGGTGTTTGTCCCAGATGACGG - Intronic
962632202 3:137289580-137289602 GTGGTGTGTTCCCAAGAGGATGG - Intergenic
962910300 3:139842404-139842426 GTGGTGTGTGTGAAACATAGAGG + Intergenic
965063326 3:163809582-163809604 GGGGCGTTTGTGCAAGATGGTGG - Intergenic
965810990 3:172591864-172591886 GTACTGTGGGTCCAAGCTGGGGG + Intergenic
966152389 3:176878307-176878329 GTTCTGTGGGTCCAAGCTGGGGG - Intergenic
967389099 3:188938221-188938243 GTGGGCTGCTTCCAAGATGGTGG + Intergenic
971540709 4:27813355-27813377 GTGGTGTTTGTCCACGGTGACGG - Intergenic
973041542 4:45475645-45475667 GCGGTGTTTGTCCGAGATGATGG - Intergenic
974281946 4:59806813-59806835 GTTGTGTTCTTCCAAGATGGTGG + Intergenic
975514553 4:75232215-75232237 GTGGTGTGTGTCCAAGTGGTGGG - Intergenic
975601707 4:76106867-76106889 GTGGTGTTTGTCCAAGATGACGG + Intronic
976298585 4:83496510-83496532 GTGGTGTTTGTCCGAGATGACGG + Intronic
977054468 4:92173386-92173408 GCAGTGTTTGTCCAAGATGACGG + Intergenic
977251369 4:94692942-94692964 GTGGGCTGCTTCCAAGATGGCGG - Intergenic
980323840 4:131314927-131314949 GAGTTGTCTGTCCAATATGGTGG - Intergenic
980871923 4:138621829-138621851 GTGGGCTGCTTCCAAGATGGTGG + Intergenic
983547695 4:168979997-168980019 GTGTTGTGGGCCCAAGCTGGGGG - Intronic
983649936 4:170027311-170027333 GTGGGGTGTGGCCAAGAGGGCGG - Intronic
983680485 4:170347639-170347661 GTGGTGTTTGTCCGAGATGACGG + Intergenic
985025956 4:185739584-185739606 GAGGTGTGTGTTCAGGATGAGGG + Intronic
986711887 5:10493646-10493668 GAGGTGTGTCTCCAGGATAGAGG - Intergenic
987246717 5:16056444-16056466 GTGGTGTGCTTGAAAGATGGAGG + Intergenic
991403963 5:66283791-66283813 GTGGTGTGTGCCTGACATGGTGG + Intergenic
991624244 5:68582762-68582784 GTGATGTGTGTCCTAGAAGAGGG - Intergenic
992125574 5:73636620-73636642 GTAGAGTGTGTGCAAGATGAAGG + Intronic
995389567 5:111625686-111625708 GTGCTTTCTGACCAAGATGGGGG + Intergenic
996128333 5:119751889-119751911 GTGGGCTGCTTCCAAGATGGTGG - Intergenic
997533130 5:134594936-134594958 GTGGAGAGTGTCCTAGAAGGAGG - Intergenic
997702919 5:135917344-135917366 GTGCTGTTTTTCCTAGATGGGGG + Intergenic
998259574 5:140619258-140619280 GCTGTGTTTGTCCAAGATGATGG - Intergenic
999210554 5:149884813-149884835 GTGGTGTCTTTCCAAGATAGAGG + Exonic
1000026249 5:157361621-157361643 GTGGGGTGTCTCCAGGTTGGAGG + Intronic
1000346765 5:160321121-160321143 GTGGTGTGTCGCCCACATGGTGG - Intronic
1002649229 5:180679539-180679561 GTGGTGTTTGTCCGAGATGACGG - Intergenic
1003662919 6:8080459-8080481 GTGGTGTGTGACTCAGATGAAGG + Intronic
1004626366 6:17380985-17381007 GGGGTTTATGTCCAAGTTGGTGG - Intergenic
1005882604 6:30072381-30072403 ATGGTGGATGACCAAGATGGTGG + Intronic
1006517843 6:34554649-34554671 GTGGTGGGACTCCAAGCTGGGGG + Intronic
1007082707 6:39119765-39119787 GTGGGGGGTGTGGAAGATGGAGG - Intergenic
1007162078 6:39799897-39799919 CTGGTGTGTATACAGGATGGAGG + Intronic
1007798099 6:44367573-44367595 TGGGTGTGTGGCAAAGATGGAGG + Intronic
1010893069 6:81337649-81337671 GTGGGCTGCTTCCAAGATGGTGG - Intergenic
1010895083 6:81351798-81351820 GTGGGCTGCTTCCAAGATGGTGG - Intergenic
1010992302 6:82493154-82493176 GTCGTGTGTGATCAAGGTGGGGG + Intergenic
1011660707 6:89591734-89591756 GTGGTGTGTGTTTAAGAGGGTGG + Intronic
1012545594 6:100415712-100415734 GCGGTGTTTGTCCGAGATGATGG - Intronic
1013884957 6:114952382-114952404 GTGGTGTTTGTCCAAGATGATGG - Intergenic
1014957878 6:127643302-127643324 GTGGTGTTTGTCCGAAATGATGG + Intergenic
1017689229 6:156946416-156946438 TTAGTGAGTGTCCAAGATAGAGG + Intronic
1017887675 6:158612263-158612285 GGGGTGTTTGTCCAAGATGACGG + Intronic
1017888612 6:158621352-158621374 GCAGTGTTTGTCCAAGATGAAGG + Intronic
1019386147 7:757296-757318 GTGGTGTGTGGCCAAGAAAGGGG - Intronic
1020586942 7:10080280-10080302 GTGGTATTTGTCCAAGATGATGG - Intergenic
1020767366 7:12340674-12340696 GCGGTGTTTGTCCAAGATGACGG + Intronic
1030162498 7:106523481-106523503 GGGGTGAGTGTCAAAGATGACGG - Intergenic
1030374938 7:108744459-108744481 GTGCTGTGGGTCCAAGCTGGGGG + Intergenic
1032489824 7:132316006-132316028 GTTGTATGTTTCCAGGATGGGGG + Intronic
1033068866 7:138183259-138183281 GATGTGTGTGTGGAAGATGGTGG - Intergenic
1034449358 7:151129143-151129165 GTGGCCTGTGTCCCAGCTGGGGG + Intronic
1034922501 7:155095485-155095507 GTGGTGTTTGTCCAAGATGGCGG - Intergenic
1035529714 8:341550-341572 GTGTTGTGGGACCATGATGGAGG - Intergenic
1035859187 8:3009738-3009760 GTGGAATTTGTCCAACATGGAGG + Intronic
1038441393 8:27573092-27573114 GTGCTGGGTGCCCAGGATGGAGG + Intergenic
1039977482 8:42379738-42379760 GTGAGGTGTGTGCAAGAGGGAGG + Intergenic
1040864944 8:52039395-52039417 AAGGTGTGTGTTGAAGATGGGGG - Intergenic
1040920227 8:52607844-52607866 ATGGTGTTTGTCCAAGATGATGG + Intergenic
1041003558 8:53477031-53477053 GTGGTCTTTGTGCAAGATTGTGG - Intergenic
1041012819 8:53560306-53560328 GTGCTGTGAGCCCAAGCTGGGGG - Intergenic
1043851547 8:85221725-85221747 GCGGTGTTTGTCCGAGATGACGG + Intronic
1046234080 8:111398382-111398404 GCAGTGTTTGTCCAAGATGACGG + Intergenic
1046486371 8:114894076-114894098 GTGCTGGGGGTCCAAGCTGGGGG + Intergenic
1047637340 8:126778969-126778991 GCAGTGTTTGTCCAAGATGACGG - Intergenic
1047803270 8:128331979-128332001 GTGGTGTGTGTATGATATGGGGG + Intergenic
1048309182 8:133305220-133305242 GTATTGTGTTTCCAAGATAGAGG - Intergenic
1049054721 8:140226892-140226914 GAGGTCTGTGTCCAAAAAGGAGG - Intronic
1049172754 8:141172094-141172116 GTGGTGGGTGTGCACGGTGGTGG + Intronic
1049410695 8:142472684-142472706 CAGGAGTGTGACCAAGATGGGGG + Intronic
1052240141 9:26261881-26261903 GTGGTGTTTGTCCAAGATGATGG + Intergenic
1055068039 9:72138358-72138380 GTGGTGTTTGTCCAAGATGATGG + Intronic
1055086876 9:72323394-72323416 GTGGTGTTTGTCCAACATGACGG + Intergenic
1056745160 9:89295358-89295380 GCGGTGTTTGTCCCAGATGACGG - Intergenic
1057211433 9:93203005-93203027 GAGGTCTGTGTCCAAGTGGGTGG + Intronic
1058311284 9:103506043-103506065 GTGGTCTGTGGCAATGATGGTGG + Intergenic
1060771062 9:126332589-126332611 ATGGTGTGTGTCCTGTATGGAGG + Intronic
1061667892 9:132170899-132170921 GTGGGGTTGGTCCAGGATGGTGG + Intronic
1061773357 9:132944599-132944621 GTGCTGTACGTCCAAGATGGCGG - Exonic
1185619201 X:1443009-1443031 GTGGTGTCTCTCCAAGATGGCGG - Intronic
1185619204 X:1443028-1443050 GTGGTATGCGTCCAAGATGGTGG - Intronic
1185619207 X:1443047-1443069 ACGGTGTGTGTCCACGATGGTGG - Intronic
1185619215 X:1443104-1443126 GCGGTGTGTGTCCACGACGACGG - Intronic
1185619217 X:1443123-1443145 GCGGCGTGTGTCCACGACGGCGG - Intronic
1185619220 X:1443142-1443164 GCGGTGTGTGTCCAAGATGGCGG - Intronic
1185619223 X:1443161-1443183 GCGGTGTGTGTCCACGATGGCGG - Intronic
1185619226 X:1443180-1443202 GCAGTGTGTGTCCACGATGGCGG - Intronic
1185619233 X:1443237-1443259 GCGGCGTGTGTCCACGACGGCGG - Intronic
1185619236 X:1443256-1443278 GCGGTGTGTGTCCAAGACGGCGG - Intronic
1185619239 X:1443275-1443297 GCGGTGTGTGTCCATGATGGCGG - Intronic
1185619242 X:1443294-1443316 GCGGTGTGTGTCCAAGATGGCGG - Intronic
1185619245 X:1443313-1443335 GCGGTGTGTGTCCAAGATGGCGG - Intronic
1185619248 X:1443332-1443354 GCGGTGTCTGTCCAAGATGGCGG - Intronic
1185619251 X:1443351-1443373 GTGGTGTGTGTCCAAGATGGCGG - Intronic
1185619254 X:1443370-1443392 GCGGCGTGTGTCCATGATGGTGG - Intronic
1185619257 X:1443389-1443411 GCGGCGTGTGTCCAAGATGGCGG - Intronic
1185619260 X:1443408-1443430 GCGGTGTGTGTCCAAGATGGCGG - Intronic
1185619263 X:1443427-1443449 GCGGTGTCTGTCCAAGATGGCGG - Intronic
1185619266 X:1443446-1443468 GTGGTGTGTGTCCAAGATGGCGG - Intronic
1185619269 X:1443465-1443487 GCGGCATGTGTCCACGATGGTGG - Intronic
1185619278 X:1443529-1443551 GAGGTGTCTGTCCAAGATGGCGG - Intronic
1185619281 X:1443548-1443570 GCGGTGTGTGTCCAAGATGGAGG - Intronic
1185619284 X:1443567-1443589 GCGGTGTGTGTCCATGATGGCGG - Intronic
1185619287 X:1443586-1443608 GCGGTGTCTGTCCAAGATGGCGG - Intronic
1185619290 X:1443605-1443627 GCGGTGTCTGTCCACGATGGCGG - Intronic
1185619293 X:1443624-1443646 GCGGTGTCTGTCCACGATGGCGG - Intronic
1185619296 X:1443643-1443665 GCGGTGTGTGTCCATGATGGCGG - Intronic
1185619299 X:1443662-1443684 GCGGTGTGTGTCCATGATGGCGG - Intronic
1185619302 X:1443681-1443703 GCAGTGTGTGTCCACGATGGCGG - Intronic
1185619309 X:1443728-1443750 ATGATGTCTGTCCACGATGGGGG - Intronic
1185619319 X:1443791-1443813 ATGGTGTCTGTCCACGATGGGGG - Intronic
1185619331 X:1443854-1443876 GCGGTGTCTGTCCACGATGGTGG - Intronic
1185619334 X:1443873-1443895 GGGGTGTCTGTCCACGACGGCGG - Intronic
1185619337 X:1443892-1443914 GCGGTGTGTGTCCATGATGGGGG - Intronic
1185619342 X:1443911-1443933 GGGGTGTCTGTCCAAGATGGCGG - Intronic
1185619345 X:1443930-1443952 GCAGTGTCTGTCCAAGACGGGGG - Intronic
1185619877 X:1447319-1447341 GTGGTGCTTATCCAAGATGGCGG - Intronic
1185619880 X:1447338-1447360 ATGTTGTGTGTCCAAGATGGTGG - Intronic
1185619887 X:1447392-1447414 GCAGTGTGTGTCCAAGATGGTGG - Intronic
1185619892 X:1447430-1447452 ATGGTGTGTGTCCAAGATGGTGG - Intronic
1185619900 X:1447484-1447506 GCGGTGTGTGTCCAAGATGGTGG - Intronic
1185619904 X:1447503-1447525 GTGGTGCTTCTCCCAGATGGCGG - Intronic
1185619907 X:1447522-1447544 ATGGTGTGTGTCCAAGATGGTGG - Intronic
1185619915 X:1447576-1447598 ATGGTGTGTCTCCAAGATGGTGG - Intronic
1185619920 X:1447611-1447633 GTGGTGCTTATCCAAGATGGCGG - Intronic
1185619923 X:1447630-1447652 ATGGTGTGTCTCCAAGATGGTGG - Intronic
1185619928 X:1447665-1447687 GTGGTGCTTCTCCAAGATGGCGG - Intronic
1185619931 X:1447684-1447706 ATGGTGTGTGTCCAAGATGGTGG - Intronic
1185619940 X:1447757-1447779 GCGGTGTGTGTCCAAGATGGTGG - Intronic
1185619943 X:1447776-1447798 GTGGTGCTTATCCAAGATGGCGG - Intronic
1185619946 X:1447795-1447817 GCTGTGTGTGTCCAAGATGGTGG - Intronic
1185619961 X:1447906-1447928 TGGCGGTGTGTCCAAGATGGCGG - Intronic
1185619964 X:1447923-1447945 GTGTTGTGTATCCAAGATGGCGG - Intronic
1185619969 X:1447961-1447983 GCGGTGTGTGTCCAAGATGGTGG - Intronic
1185619972 X:1447980-1448002 GTGGTTCTTATCCAAGATGGCGG - Intronic
1185619975 X:1447999-1448021 ATGGTGTGTGTCCAAGATGGTGG - Intronic
1185619980 X:1448034-1448056 GTGGTTCTTATCCAAGATGGCGG - Intronic
1185619983 X:1448053-1448075 ATGGTGTGTGTCCAAGATGGTGG - Intronic
1185619990 X:1448107-1448129 ATGGTGTGTGTCCAAGATGGTGG - Intronic
1185619995 X:1448142-1448164 GTGGTGCTTATCCAAGATGGCGG - Intronic
1185619998 X:1448161-1448183 GCGGTGTGTGTCCAAGATGGTGG - Intronic
1185620001 X:1448180-1448202 GTGGTGCTTATCCAAGATGGCGG - Intronic
1185620004 X:1448199-1448221 ATGGTGTGTGTCCAAGATGGTGG - Intronic
1185620011 X:1448253-1448275 ATGTTGTGTGTCCAAGATGGTGG - Intronic
1185620015 X:1448288-1448310 GTGGTGCTTATCCAAGATGGCGG - Intronic
1185620018 X:1448307-1448329 ATGGTGTGTGTCCAAGATGGTGG - Intronic
1185620030 X:1448380-1448402 TGGCGGTGTGTCCAAGATGGTGG - Intronic
1185620036 X:1448414-1448436 GTGGTGTGTATCCAAGATGGTGG - Intronic
1185620039 X:1448433-1448455 GTGGTGCTTTTCCAAGATGGTGG - Intronic
1185620042 X:1448452-1448474 ATGTTGTGTGTCCAAGATGGTGG - Intronic
1185620048 X:1448506-1448528 GCGGCATGTGTCCAAGATGGTGG - Intronic
1185620051 X:1448525-1448547 GCAGTGTGTGTCCAAGATGGCGG - Intronic
1185620056 X:1448563-1448585 ATGGTGTGTGTCCAAGATGGTGG - Intronic
1185620064 X:1448617-1448639 GCGGTGTGTGTCCAAGATGGTGG - Intronic
1185620067 X:1448636-1448658 GTGGTGCTTATCCAAGATGGCGG - Intronic
1185620070 X:1448655-1448677 ATGGTGTGTCTCCAAGATGGTGG - Intronic
1185620077 X:1448709-1448731 ATGGTGTGTGTCCAAGATGGTGG - Intronic
1185620083 X:1448744-1448766 GTGGTGCTTATCCAAGATGGTGG - Intronic
1185620086 X:1448763-1448785 GCGGTGTGTGTCCAAGATGGTGG - Intronic
1185620089 X:1448782-1448804 GTGGTGCTTATCCAAGATGGCGG - Intronic
1185620092 X:1448801-1448823 GCAGTGCTTGTCCAAGATGGTGG - Intronic
1185620098 X:1448858-1448880 GCGGTGTGTGTCCAAGATGGTGG - Intronic
1186031123 X:5369954-5369976 GTGGTGTGTGTCAAAATAGGCGG + Intergenic
1186063680 X:5738779-5738801 GCAGTGTTTGTCCAAGATGATGG - Intergenic
1186143369 X:6600730-6600752 GTGGTCTCTGTCCAAGAAGCAGG + Intergenic
1187552399 X:20319049-20319071 GTGGGCTGTGTCAATGATGGTGG - Intergenic
1187977395 X:24717009-24717031 GTGGTTTCTGTCAAAAATGGAGG + Intronic
1188869661 X:35358866-35358888 GTGCTGTGAGTGCAAGCTGGGGG + Intergenic
1189093212 X:38109685-38109707 GTGAAGTGTGTCCCAGATGGTGG + Intronic
1190071812 X:47285867-47285889 GCGGTATTTGTCCAAGATGACGG + Intergenic
1190122733 X:47675932-47675954 GCGGTGTTTGTCCAAGATGACGG - Intergenic
1190240613 X:48655220-48655242 GTGGGCTGCTTCCAAGATGGTGG - Intergenic
1190336234 X:49264112-49264134 ATGGAGTGTGGTCAAGATGGAGG + Intronic
1190687701 X:52889142-52889164 GTGTTGTGTGTCCAGGGTTGAGG + Intergenic
1190698281 X:52966650-52966672 GTGTTGTGTGTCCAGGGTTGAGG - Intronic
1191663560 X:63674911-63674933 GCAGTGTTTGTCCAAGATGACGG + Intronic
1194699801 X:97099793-97099815 GTGGTATGTATCCAACATGAGGG + Exonic
1195584654 X:106551699-106551721 GTGGGCTGCTTCCAAGATGGTGG - Intergenic
1195856468 X:109338025-109338047 GTGCTGTGGGCCCAAGCTGGGGG + Intergenic
1196010439 X:110881170-110881192 GATGTGTGTGTCCATGATGGTGG - Intergenic
1197104623 X:122699442-122699464 GGGCAGTGTGTCCAAGATGCTGG - Intergenic
1197402432 X:126007405-126007427 GTGCTGTCAGTCCAGGATGGAGG - Intergenic
1198112486 X:133514006-133514028 GTGGTGTGCAGCCAAGGTGGAGG - Intergenic
1199346162 X:146743637-146743659 ATGGTCTGTGTCCCAGGTGGTGG - Intergenic
1200822574 Y:7602120-7602142 GCAGTGTTTGTCCAAGATGATGG + Intergenic
1200877521 Y:8173762-8173784 TTGGTGTTTGCCCAAGATGATGG + Intergenic
1202237728 Y:22731897-22731919 GCAGTGTTTGTCCAAGATGATGG - Intergenic