ID: 1185619253

View in Genome Browser
Species Human (GRCh38)
Location X:1443359-1443381
Sequence TTGGACACACACCACCATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619246_1185619253 20 Left 1185619246 X:1443316-1443338 CCATCTTGGACACACACCGCCAT No data
Right 1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG No data
1185619249_1185619253 1 Left 1185619249 X:1443335-1443357 CCATCTTGGACAGACACCGCCAT No data
Right 1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG No data
1185619248_1185619253 4 Left 1185619248 X:1443332-1443354 CCGCCATCTTGGACAGACACCGC No data
Right 1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG No data
1185619245_1185619253 23 Left 1185619245 X:1443313-1443335 CCGCCATCTTGGACACACACCGC No data
Right 1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619253 Original CRISPR TTGGACACACACCACCATCA TGG Intronic