ID: 1185619253

View in Genome Browser
Species Human (GRCh38)
Location X:1443359-1443381
Sequence TTGGACACACACCACCATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 3, 2: 23, 3: 42, 4: 170}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619249_1185619253 1 Left 1185619249 X:1443335-1443357 CCATCTTGGACAGACACCGCCAT 0: 3
1: 27
2: 51
3: 82
4: 185
Right 1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG 0: 1
1: 3
2: 23
3: 42
4: 170
1185619246_1185619253 20 Left 1185619246 X:1443316-1443338 CCATCTTGGACACACACCGCCAT 0: 19
1: 27
2: 46
3: 99
4: 214
Right 1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG 0: 1
1: 3
2: 23
3: 42
4: 170
1185619245_1185619253 23 Left 1185619245 X:1443313-1443335 CCGCCATCTTGGACACACACCGC 0: 12
1: 16
2: 28
3: 56
4: 201
Right 1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG 0: 1
1: 3
2: 23
3: 42
4: 170
1185619248_1185619253 4 Left 1185619248 X:1443332-1443354 CCGCCATCTTGGACAGACACCGC 0: 3
1: 17
2: 24
3: 59
4: 153
Right 1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG 0: 1
1: 3
2: 23
3: 42
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619253 Original CRISPR TTGGACACACACCACCATCA TGG Intronic
902269092 1:15290219-15290241 TGGGACACACACAACCTTCAGGG + Intronic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
906054072 1:42900549-42900571 CTGAACACACACCGCCACCAGGG - Intergenic
907962425 1:59296404-59296426 TCTGACACACACACCCATCAGGG + Intergenic
909411963 1:75364608-75364630 TTGGGAAAACACCACCATCCAGG - Intronic
910015906 1:82522922-82522944 AATGACACACACAACCATCAAGG - Intergenic
914933252 1:151953533-151953555 TTGGACACTCACCACCAGACTGG + Intergenic
916327841 1:163582884-163582906 TGGGACAAACACCACTCTCAAGG - Intergenic
917557337 1:176103322-176103344 TTGCACACACACCAACCTCCAGG + Intronic
920294827 1:204949639-204949661 TGGTTCACACACCACCAGCATGG + Intronic
920362543 1:205429314-205429336 TTTGAAACACACCACCAGCGTGG - Intronic
922963365 1:229666863-229666885 TTGGACAGACACCTGCAGCAGGG + Intergenic
924714466 1:246559839-246559861 TTGGACATACTCTACCTTCAGGG - Intronic
1064467317 10:15597234-15597256 AAGGTCACACACCACCATCCTGG + Exonic
1068175744 10:53455834-53455856 TTGAACACACTCAAGCATCATGG - Intergenic
1070415847 10:76188544-76188566 TTAGACACATTCCACCATCTGGG - Intronic
1077197503 11:1288725-1288747 CTGGACCCACATCACCATCCCGG - Exonic
1077821253 11:5743635-5743657 TTGGATACACAACAAAATCAAGG + Intronic
1082044825 11:47716318-47716340 TTGATCACACAGCACCATCTGGG + Intergenic
1087468743 11:98545380-98545402 TGGAACACACACCCCCATTAGGG + Intergenic
1089940292 11:122409531-122409553 TTTCACCCACACCCCCATCAAGG - Intergenic
1090673648 11:128969643-128969665 ATGGACAGAGCCCACCATCACGG - Exonic
1091481647 12:838554-838576 ATGGACACACACCACCATGCTGG + Intronic
1097744250 12:63283777-63283799 TTGCACACATACCACCAGAAGGG + Intergenic
1098379250 12:69851798-69851820 ACAGACACACACCACCATCTTGG + Intronic
1101569535 12:105940478-105940500 TCGAAGACACACCACCATCCTGG + Intergenic
1102473195 12:113171755-113171777 ATGGACACACACCAAAATGACGG + Intronic
1102811458 12:115827696-115827718 TGTGTCACACACCACCATCACGG + Intergenic
1103101582 12:118180796-118180818 TTGTACCCAGGCCACCATCAAGG + Intronic
1104632725 12:130417912-130417934 GTGGTCTCACAACACCATCAGGG + Intronic
1104832724 12:131765092-131765114 CTGGGGACACACCACCTTCAAGG - Intronic
1119173688 14:72553844-72553866 TTCTACACACTACACCATCAGGG + Intronic
1120122864 14:80702746-80702768 TTGGAAACACACAAACCTCAGGG - Intronic
1122342871 14:101039784-101039806 CTGGACTGAAACCACCATCAGGG + Intergenic
1123016970 14:105380362-105380384 CTGGACTCACCCCACCCTCAGGG + Intronic
1123017018 14:105380491-105380513 CTGGACTCACCCCACCCTCAGGG + Intronic
1123017031 14:105380523-105380545 CTGGACTCACCCCACCCTCAGGG + Intronic
1125550564 15:40541472-40541494 ATGGGCACACACCACCAACCCGG + Intronic
1126321042 15:47423810-47423832 TTAGACAAACCCCACCACCAAGG - Intronic
1127327127 15:57906612-57906634 TTGGAAACAGACCACCAACAGGG - Intergenic
1127368490 15:58313383-58313405 GTGTAGACACCCCACCATCAGGG - Intronic
1129381769 15:75172342-75172364 GTGGACACAAACCACCTCCATGG - Intergenic
1131811055 15:96173420-96173442 TAGGACACAGAGCAACATCAAGG - Intergenic
1134804539 16:17113441-17113463 GTGGACAAAAACCACTATCATGG - Intronic
1142299752 16:89249593-89249615 TTGGAAATAGACCACCATGATGG - Intergenic
1143434496 17:6913868-6913890 TGGGATACACACCCCCACCAGGG + Intronic
1144530799 17:16037166-16037188 CAGGACACACACCACCTTTATGG + Intronic
1146431130 17:32796003-32796025 TTGGACACTCAGCACCGTTAAGG - Intronic
1146453234 17:32991100-32991122 CTGCACACCCACCACCATCCTGG + Intronic
1147383110 17:40067244-40067266 TGGGACACACCCCACCAGCTAGG + Intronic
1153779758 18:8484125-8484147 ATAAACACACACCAACATCAAGG + Intergenic
1154158402 18:11961202-11961224 CTGGACACACACCCACTTCAGGG - Intergenic
1154637500 18:16876670-16876692 TGAGACACCCACCACCATCCAGG - Intergenic
1158504859 18:58038195-58038217 TTGGCCACACAGCAGCATCAGGG - Intergenic
1158591390 18:58781807-58781829 TTATACACACACCACCACCAAGG - Intergenic
1160389596 18:78520142-78520164 TTGGACGCAGCCCACCATCCAGG - Intergenic
1161698361 19:5782621-5782643 TTGGAGACACACAGCCATCAGGG - Intergenic
1168308453 19:55449415-55449437 GTGGACACACAACACAAACATGG + Intergenic
925024535 2:597292-597314 CTGGGGACACACCACCATCAAGG + Intergenic
925178740 2:1802866-1802888 TTGGCCACACAGCACCACAATGG + Intronic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
927887068 2:26725147-26725169 GCAGACACATACCACCATCAGGG - Intronic
931912497 2:66916668-66916690 CTGCACAGACACCACCTTCAGGG + Intergenic
933131697 2:78681050-78681072 TGGGATACACACCCCCACCAGGG + Intergenic
935795275 2:106634910-106634932 TTGGACACAGACCACACACAGGG + Intergenic
936058886 2:109281725-109281747 CTGCACCCACTCCACCATCATGG - Intronic
940366372 2:152852658-152852680 TGGGATACACACCCCCACCAGGG - Intergenic
940656608 2:156494712-156494734 TGGGAAAAACACCACCATCATGG + Intronic
946326950 2:218989551-218989573 GTGGACACACCCCAACAACAGGG - Intergenic
948200277 2:236124619-236124641 TTTGACACACACCATCATAGGGG - Exonic
948388784 2:237597770-237597792 TTGGACACAGGCCTCCATCCAGG + Intronic
1173819055 20:46009102-46009124 TGGGACACTCAACACCCTCACGG - Intronic
1176267430 20:64217555-64217577 TTGGACACACACGCCCGTAACGG - Intronic
1176686510 21:9852662-9852684 TGAGACACCCACCACCATCCAGG - Intergenic
1176965854 21:15210529-15210551 TTAGACACACACCACGGGCAAGG + Intergenic
1180090160 21:45529994-45530016 ATGGACACACACCACACACACGG - Intronic
1181980631 22:26763497-26763519 TTGGACACAGATCACCATAGAGG - Intergenic
1184012368 22:41758768-41758790 GTGGACAAACAACACCCTCAAGG - Intronic
1185373177 22:50470165-50470187 TTGGCCCCAAACCACCATCTGGG + Intronic
953575956 3:44113420-44113442 ATGGACACACTTAACCATCACGG - Intergenic
954446536 3:50549854-50549876 TTGGACAGCCTCCACCAGCATGG - Intergenic
954458838 3:50614590-50614612 TTGGACACACAGCTACATGAAGG + Intronic
962361708 3:134748655-134748677 CTGGACACACACCAGCATACAGG - Intronic
969510765 4:7616521-7616543 TCAGACACCCACCACCCTCAAGG + Intronic
974990763 4:69085753-69085775 TTGGACACATACCACCAACCAGG - Intronic
975570885 4:75816660-75816682 TTGGTCACAGGCCACAATCAAGG + Intergenic
980349958 4:131671131-131671153 TGAGACACCCACCACCATCCAGG - Intergenic
982045432 4:151440610-151440632 TAGGATAGTCACCACCATCATGG + Intronic
987911300 5:24149697-24149719 TTGGTCACCCAGCACTATCATGG - Intronic
989719165 5:44504253-44504275 TTGGCCACACAGCAGCATCCAGG - Intergenic
991767688 5:70004957-70004979 TGGAACACTCACCGCCATCACGG + Intergenic
991846922 5:70880033-70880055 TGGAACACTCACCGCCATCACGG + Intergenic
995260868 5:110103232-110103254 CTGCACACACCCCACCAACAGGG + Intergenic
998980806 5:147699948-147699970 TAGGTCACACACCACCATGAAGG - Intronic
998980949 5:147701597-147701619 TAGGTCACACACCAGCATGAAGG + Intronic
1001669834 5:173464353-173464375 TGGCAACCACACCACCATCAAGG + Intergenic
1001860676 5:175052001-175052023 TAGGGGACACACTACCATCAGGG + Intergenic
1002261161 5:177994971-177994993 CTGGACACACACGACCACCTGGG + Intronic
1002706325 5:181162801-181162823 GTGGACACACAGGGCCATCACGG + Intergenic
1004454603 6:15780276-15780298 TTGGAAAGACACCATCATCCTGG - Intergenic
1005706075 6:28454838-28454860 TTGGAGACACAGCACCATTTAGG + Intergenic
1006082470 6:31575356-31575378 TTGGGGACACACAAGCATCAAGG - Intergenic
1010917455 6:81637861-81637883 TTGCACTTACACCACCATCTTGG + Intronic
1012914587 6:105155890-105155912 TTGGCCACACATTGCCATCATGG - Intergenic
1014418771 6:121215352-121215374 TGGGACTCCCACCAGCATCATGG + Intronic
1015250821 6:131125714-131125736 TTGTAACCACACCACCAGCAGGG + Intergenic
1015711469 6:136146083-136146105 TTGGTCACTCACTGCCATCAGGG + Intronic
1018530445 6:164757585-164757607 TATGATACACACCACCACCATGG + Intergenic
1022439880 7:30424624-30424646 TTGGACACCCCCCACCATGGTGG - Exonic
1022578580 7:31524112-31524134 TTGGATACTCACCAATATCAGGG - Intronic
1026595036 7:71727269-71727291 CTGCACACACACCCCCACCATGG - Intergenic
1033937802 7:146609633-146609655 TTGGACAAACACCTCTACCATGG - Intronic
1035016968 7:155775025-155775047 TAGGACTCACTCCACGATCAGGG - Exonic
1035270551 7:157717376-157717398 TTGGACACTCAGCACCTGCATGG + Intronic
1040155077 8:44179548-44179570 GAGAACACACACCACAATCAAGG - Intergenic
1040157187 8:44210816-44210838 GAGAACACACACCACAATCAAGG - Intergenic
1040160906 8:44265993-44266015 GAGAACACACACCACAATCAAGG - Intergenic
1040202511 8:44881865-44881887 GAGAACACACACCACAATCAAGG - Intergenic
1040213207 8:45040340-45040362 GAGAACACACACCACAATCAAGG - Intergenic
1040217926 8:45110034-45110056 GAGAACACACACCACAATCAAGG - Intergenic
1040229808 8:45285441-45285463 GAGAACACACACCACAATCAAGG - Intergenic
1040267754 8:45845252-45845274 GAGAACACACACCACAATCAAGG - Intergenic
1043326996 8:79064597-79064619 TTGGCCACAAACCACAATCAAGG + Intergenic
1044863272 8:96544284-96544306 TTGAACTGAGACCACCATCAAGG - Intronic
1047679590 8:127240808-127240830 TTTGACACCCACCATCATCCAGG + Intergenic
1048871494 8:138802988-138803010 TTGCACACACAGGACCCTCACGG + Intronic
1049529773 8:143148396-143148418 ATGGGCACCCACCCCCATCATGG + Intergenic
1049867475 8:144948137-144948159 CTGGACTCAGATCACCATCAAGG + Intronic
1050035196 9:1427972-1427994 ATGAAGAAACACCACCATCAGGG + Intergenic
1050978672 9:11978172-11978194 TAGACCACACACCACGATCAGGG + Intergenic
1051694635 9:19754713-19754735 TTTGGCACATACCACCACCAGGG - Intronic
1053782810 9:41628930-41628952 TGAGACACCCACCACCATCCAGG + Intergenic
1054170761 9:61839070-61839092 TGAGACACCCACCACCATCCAGG + Intergenic
1054666775 9:67741737-67741759 TGAGACACCCACCACCATCCAGG - Intergenic
1056805396 9:89724926-89724948 TTGGACACACACCAGCACAGAGG + Intergenic
1058275551 9:103037524-103037546 TGGGATACACACCCCCACCAGGG + Intergenic
1059940078 9:119350160-119350182 GGGGACACACACCAGCATCTGGG + Intronic
1060332536 9:122686146-122686168 TGAAACACACACCACCATCCAGG + Intergenic
1060887614 9:127166815-127166837 TCTTACACACCCCACCATCATGG - Intronic
1185603323 X:1353966-1353988 TGGGACCCCCACCCCCATCATGG + Intronic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619203 X:1443017-1443039 TTGGAGAGACACCACCATCTTGG + Intronic
1185619206 X:1443036-1443058 TTGGACGCATACCACCATCGTGG + Intronic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619216 X:1443112-1443134 GTGGACACACACCGCCGTCGTGG + Intronic
1185619219 X:1443131-1443153 GTGGACACACGCCGCCATCTTGG + Intronic
1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG + Intronic
1185619225 X:1443169-1443191 GTGGACACACACCGCCATCGTGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619256 X:1443378-1443400 ATGGACACACGCCGCCATCTTGG + Intronic
1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic
1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG + Intronic
1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619289 X:1443594-1443616 TTGGACAGACACCGCCATCGTGG + Intronic
1185619292 X:1443613-1443635 GTGGACAGACACCGCCATCGTGG + Intronic
1185619295 X:1443632-1443654 GTGGACAGACACCGCCATCATGG + Intronic
1185619298 X:1443651-1443673 ATGGACACACACCGCCATCATGG + Intronic
1185619301 X:1443670-1443692 ATGGACACACACCGCCATCGTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619308 X:1443717-1443739 GTGGACACACACCCCCATCGTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619318 X:1443780-1443802 GTGGACACACACCCCCATCGTGG + Intronic
1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG + Intronic
1185619330 X:1443843-1443865 GAGGACACACACCACCATCGTGG + Intronic
1185619336 X:1443881-1443903 GTGGACAGACACCCCCATCATGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619344 X:1443919-1443941 TTGGACAGACACCCCCGTCTTGG + Intronic
1185619870 X:1447270-1447292 TTCGACACACACTGCCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619879 X:1447327-1447349 TTGGATAAGCACCACCATCTTGG + Intronic
1185619884 X:1447362-1447384 TTGGACACACATGGCCATCTTGG + Intronic
1185619886 X:1447381-1447403 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619891 X:1447419-1447441 TTGGATAAGCACCACCATCTTGG + Intronic
1185619897 X:1447454-1447476 TTGGACACACACGGCCATGTTGG + Intronic
1185619899 X:1447473-1447495 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619912 X:1447546-1447568 TTGGACACACACGGCCATCTTGG + Intronic
1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619922 X:1447619-1447641 TTGGATAAGCACCACCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619930 X:1447673-1447695 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619939 X:1447746-1447768 TTTGACACACACCACCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619945 X:1447784-1447806 TTGGATAAGCACCACCATCTTGG + Intronic
1185619948 X:1447803-1447825 TTGGACACACACAGCTATCTTGG + Intronic
1185619954 X:1447857-1447879 TGGGACACACACTGCCATCTTGG + Intronic
1185619956 X:1447876-1447898 TTGGACCCATAACACCATCTTGG + Intronic
1185619960 X:1447895-1447917 TTGGACAAGCACCGCCATCTTGG + Intronic
1185619966 X:1447931-1447953 TTGGATACACAACACCATCTTGG + Intronic
1185619968 X:1447950-1447972 TTGGAAAAGCACCACCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185619989 X:1448096-1448118 TTGGATAAGCACCACCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185619997 X:1448150-1448172 TTGGATAAGCACCACCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620003 X:1448188-1448210 TTGGATAAGCACCACCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620010 X:1448242-1448264 TTGGATAAGCACCACCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620017 X:1448296-1448318 TTGGATAAGCACCACCATCTTGG + Intronic
1185620023 X:1448331-1448353 TGGGACACACACTGCCATCTTGG + Intronic
1185620025 X:1448350-1448372 TTGGACCCATAACACCATCTTGG + Intronic
1185620029 X:1448369-1448391 TTGGACAAGCACCACCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185620041 X:1448441-1448463 TTGGAAAAGCACCACCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620047 X:1448495-1448517 TTGGATAAGCACCACCATCTTGG + Intronic
1185620050 X:1448514-1448536 TTGGACACATGCCGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620055 X:1448552-1448574 TTGGATAAGCACCACCATCTTGG + Intronic
1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG + Intronic
1185620063 X:1448606-1448628 TTGGATAAGCACCACCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620069 X:1448644-1448666 TTGGATAAGCACCACCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1185620076 X:1448698-1448720 TTGGAGAAGCACCACCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1185620085 X:1448752-1448774 TTGGATAAGCACCACCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG + Intronic
1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1190250140 X:48717137-48717159 TGGGACACACACCACCAAATAGG + Intergenic
1197166100 X:123379319-123379341 TTGGACACACAAAACCCTCATGG - Intronic