ID: 1185619254

View in Genome Browser
Species Human (GRCh38)
Location X:1443370-1443392
Sequence GCGGCGTGTGTCCATGATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 6, 2: 17, 3: 23, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619254_1185619262 23 Left 1185619254 X:1443370-1443392 CCACCATCATGGACACACGCCGC 0: 1
1: 6
2: 17
3: 23
4: 90
Right 1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG 0: 17
1: 19
2: 26
3: 16
4: 133
1185619254_1185619259 4 Left 1185619254 X:1443370-1443392 CCACCATCATGGACACACGCCGC 0: 1
1: 6
2: 17
3: 23
4: 90
Right 1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG 0: 1
1: 20
2: 20
3: 25
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619254 Original CRISPR GCGGCGTGTGTCCATGATGG TGG (reversed) Intronic
901301007 1:8200229-8200251 GCAGCTTGAGTCTATGATGGTGG + Intergenic
903376525 1:22869877-22869899 GCTGCGAGTGCCGATGATGGGGG - Intronic
904041655 1:27588856-27588878 GCCGTGTGTGTACATGATGGAGG + Intronic
904061348 1:27713376-27713398 GCAGCGTTTGTCCAAGATGATGG - Intergenic
913283710 1:117209096-117209118 GCAGCGACTGTCCATGAGGGTGG - Intronic
913404966 1:118480237-118480259 GCGGGGGGTGTGCATAATGGGGG + Intergenic
920951432 1:210575029-210575051 GAGGTGTATGTCCAAGATGGTGG + Intronic
1063371351 10:5524895-5524917 GGGGCGTCTGCCAATGATGGGGG + Exonic
1064889210 10:20150029-20150051 GTGGGGTATGTCGATGATGGGGG - Intronic
1065807652 10:29409776-29409798 GCTGCAAGTGTCCACGATGGCGG + Intergenic
1067077546 10:43196820-43196842 GGGGCGAGTGTGCATGAGGGTGG - Intronic
1070393105 10:75988455-75988477 GAGGCATGTGTGCATGTTGGGGG - Intronic
1072711470 10:97718367-97718389 ACTGCCTGTGTCCCTGATGGAGG + Intergenic
1076680907 10:132170643-132170665 CCAGCGTGTGTCCATGGGGGCGG + Intronic
1084717614 11:70883691-70883713 CCGGCGTGGGTCCAGGAGGGTGG - Intronic
1086059852 11:82689551-82689573 ACGGCTGGTGTCCATGATGGCGG - Intergenic
1088036545 11:105324314-105324336 GCGGAGTGTTTCCCTGATGCAGG - Intergenic
1090393893 11:126406696-126406718 ACGGAGTGTTTCCATGAGGGTGG + Intronic
1091999402 12:5020078-5020100 GCTTCATGTGTCCATGAAGGGGG - Intergenic
1093930179 12:24948505-24948527 GCAGCGTGTGTTCGTGATGCAGG - Intronic
1096719525 12:53510754-53510776 GCTTCCTGTGTCCAGGATGGAGG + Intronic
1118215929 14:63808538-63808560 ATGGCTGGTGTCCATGATGGTGG - Intergenic
1118681956 14:68250900-68250922 ACAGCTTGTGTCCATGAAGGTGG - Intronic
1121495447 14:94388836-94388858 GCGTCCTGTGTCCAAGGTGGAGG + Exonic
1122388621 14:101365321-101365343 CCGGCGAGTGGCCATGCTGGGGG + Intergenic
1123412816 15:20073729-20073751 GCTGCGTGTGTCCATGGACGAGG + Intergenic
1123522158 15:21080842-21080864 GCTGCGTGTGTCCATGGACGAGG + Intergenic
1124464032 15:29920080-29920102 TCGGCATCTGTGCATGATGGTGG - Intronic
1132583724 16:696776-696798 GAGGCCTGCGTCCGTGATGGTGG + Exonic
1134584074 16:15396041-15396063 GCGGCGCGTGGCCACGTTGGTGG + Exonic
1136192219 16:28623275-28623297 GCGGCGCGTGGCCACGTTGGTGG - Exonic
1137400185 16:48146921-48146943 GCGGTGTGTGTGCATGTTTGTGG - Intronic
1138967565 16:62103468-62103490 GCGGTGTTTGTCCAAGATGATGG + Intergenic
1140476661 16:75242497-75242519 GCTGCGTGTGTCCATGGACGGGG + Exonic
1140888934 16:79268803-79268825 GCGGCTTGTGTGCATGATGTTGG - Intergenic
1144899626 17:18572744-18572766 ACGGCTGGTGTCCAAGATGGCGG - Intergenic
1148785440 17:50143997-50144019 AGGGCGTGTGGCCAGGATGGGGG + Intronic
1149943672 17:60898814-60898836 GTGGCGTGTGTTGATGTTGGTGG + Intronic
1151591441 17:75047235-75047257 GCGGCGGCGGTCCAAGATGGCGG + Exonic
1151669260 17:75563037-75563059 CCGGCGTGTGTTCGAGATGGTGG + Exonic
1152114735 17:78378653-78378675 GCGGCGAGTCTCCATGGCGGTGG + Exonic
1153383916 18:4470816-4470838 GCGGCTTGTCTCCATGTTAGTGG - Intergenic
1157557501 18:48622287-48622309 GTGGCGTGTGTCCAGGAGTGGGG + Intronic
1162097854 19:8321523-8321545 ACGGCTGGTGTCCATGATGGCGG - Exonic
1165361862 19:35341715-35341737 GCTGCGTGTGTCCATGAGCCCGG + Exonic
1165364793 19:35358883-35358905 GGGGCCTGTATCCATGGTGGTGG - Exonic
1165366611 19:35371352-35371374 GGGGCCTGTATCCATGGTGGTGG - Exonic
1167660705 19:50794495-50794517 GCGGGGTGTGTCCATCATAGAGG - Exonic
925600433 2:5603503-5603525 GCGCTGTCTGTCCAGGATGGTGG - Intergenic
930599214 2:53424456-53424478 GCGGTGTTTGTCCAAGATGACGG + Intergenic
932802604 2:74754805-74754827 ACGGCTGGTGTTCATGATGGCGG + Intergenic
934517649 2:94998761-94998783 ACGGCATGTGCCCAGGATGGGGG - Intergenic
942178182 2:173354956-173354978 GCGGCGAGCGTCCATGCTGGTGG - Exonic
944580462 2:201127662-201127684 GCAGCGTGTGTGTATGCTGGAGG - Intronic
947573735 2:231256089-231256111 ACGGCTGGTGTCCATGATGGCGG - Intronic
948745299 2:240087821-240087843 GCGGTGTTTGTCCAAGATGACGG + Intergenic
1175400756 20:58698721-58698743 GCAGGGTGTGTCCACGATGCGGG - Exonic
1179264769 21:39793699-39793721 GCGTTGTGTATTCATGATGGTGG + Intronic
1180617042 22:17135174-17135196 GTGGCGTGTGTGAATGATGATGG + Intergenic
1180742977 22:18066640-18066662 GTGCCGTGTGTCCTTGTTGGTGG + Intergenic
1181667215 22:24406562-24406584 GCGGGTTGTGTGCATGGTGGCGG + Intronic
1182784937 22:32899513-32899535 GAGGGGTTGGTCCATGATGGAGG + Intronic
1183368526 22:37419650-37419672 TTGGCGTGTGTCTATGTTGGGGG - Intronic
1185137603 22:49081489-49081511 GCTGCGGGTGTGGATGATGGTGG + Intergenic
965063326 3:163809582-163809604 GGGGCGTTTGTGCAAGATGGTGG - Intergenic
981730012 4:147887270-147887292 GCTGCCTGTGTTCCTGATGGAGG + Intronic
1002339075 5:178502858-178502880 GGGGCGTGTGGGCGTGATGGTGG - Intronic
1002618260 5:180468775-180468797 GCAGCGTGGGTCCCTGGTGGGGG + Intergenic
1017659183 6:156657223-156657245 TCTGCGTGTGTGTATGATGGAGG - Intergenic
1019132391 6:169886777-169886799 GCGGCGGGCCACCATGATGGAGG + Intergenic
1020767366 7:12340674-12340696 GCGGTGTTTGTCCAAGATGACGG + Intronic
1026620040 7:71942251-71942273 GTGGCTGGTGTCCATGACGGCGG - Intronic
1029856737 7:103525000-103525022 GAGGCGAGTGACCATGATGAGGG - Intronic
1034922501 7:155095485-155095507 GTGGTGTTTGTCCAAGATGGCGG - Intergenic
1041027607 8:53703316-53703338 GCTGCGTGTCTCCAGGCTGGAGG - Intergenic
1048974276 8:139662333-139662355 GCTGGGTGTGGCCAGGATGGGGG + Intronic
1055744420 9:79427109-79427131 GCCGCGTGTGTCCTGGTTGGGGG + Intergenic
1057230646 9:93319529-93319551 ACGGGCTGTGACCATGATGGAGG + Intronic
1058977544 9:110138385-110138407 GCGGACTTTGTCCATGATTGAGG + Exonic
1061241835 9:129378899-129378921 GCTGCGTGTGTTCGTGGTGGGGG + Intergenic
1185619207 X:1443047-1443069 ACGGTGTGTGTCCACGATGGTGG - Intronic
1185619215 X:1443104-1443126 GCGGTGTGTGTCCACGACGACGG - Intronic
1185619217 X:1443123-1443145 GCGGCGTGTGTCCACGACGGCGG - Intronic
1185619220 X:1443142-1443164 GCGGTGTGTGTCCAAGATGGCGG - Intronic
1185619223 X:1443161-1443183 GCGGTGTGTGTCCACGATGGCGG - Intronic
1185619226 X:1443180-1443202 GCAGTGTGTGTCCACGATGGCGG - Intronic
1185619233 X:1443237-1443259 GCGGCGTGTGTCCACGACGGCGG - Intronic
1185619236 X:1443256-1443278 GCGGTGTGTGTCCAAGACGGCGG - Intronic
1185619239 X:1443275-1443297 GCGGTGTGTGTCCATGATGGCGG - Intronic
1185619242 X:1443294-1443316 GCGGTGTGTGTCCAAGATGGCGG - Intronic
1185619245 X:1443313-1443335 GCGGTGTGTGTCCAAGATGGCGG - Intronic
1185619248 X:1443332-1443354 GCGGTGTCTGTCCAAGATGGCGG - Intronic
1185619251 X:1443351-1443373 GTGGTGTGTGTCCAAGATGGCGG - Intronic
1185619254 X:1443370-1443392 GCGGCGTGTGTCCATGATGGTGG - Intronic
1185619257 X:1443389-1443411 GCGGCGTGTGTCCAAGATGGCGG - Intronic
1185619260 X:1443408-1443430 GCGGTGTGTGTCCAAGATGGCGG - Intronic
1185619263 X:1443427-1443449 GCGGTGTCTGTCCAAGATGGCGG - Intronic
1185619266 X:1443446-1443468 GTGGTGTGTGTCCAAGATGGCGG - Intronic
1185619269 X:1443465-1443487 GCGGCATGTGTCCACGATGGTGG - Intronic
1185619278 X:1443529-1443551 GAGGTGTCTGTCCAAGATGGCGG - Intronic
1185619281 X:1443548-1443570 GCGGTGTGTGTCCAAGATGGAGG - Intronic
1185619284 X:1443567-1443589 GCGGTGTGTGTCCATGATGGCGG - Intronic
1185619287 X:1443586-1443608 GCGGTGTCTGTCCAAGATGGCGG - Intronic
1185619290 X:1443605-1443627 GCGGTGTCTGTCCACGATGGCGG - Intronic
1185619293 X:1443624-1443646 GCGGTGTCTGTCCACGATGGCGG - Intronic
1185619296 X:1443643-1443665 GCGGTGTGTGTCCATGATGGCGG - Intronic
1185619299 X:1443662-1443684 GCGGTGTGTGTCCATGATGGCGG - Intronic
1185619302 X:1443681-1443703 GCAGTGTGTGTCCACGATGGCGG - Intronic
1185619331 X:1443854-1443876 GCGGTGTCTGTCCACGATGGTGG - Intronic
1185619337 X:1443892-1443914 GCGGTGTGTGTCCATGATGGGGG - Intronic
1185619342 X:1443911-1443933 GGGGTGTCTGTCCAAGATGGCGG - Intronic
1185619887 X:1447392-1447414 GCAGTGTGTGTCCAAGATGGTGG - Intronic
1185619892 X:1447430-1447452 ATGGTGTGTGTCCAAGATGGTGG - Intronic
1185619900 X:1447484-1447506 GCGGTGTGTGTCCAAGATGGTGG - Intronic
1185619907 X:1447522-1447544 ATGGTGTGTGTCCAAGATGGTGG - Intronic
1185619931 X:1447684-1447706 ATGGTGTGTGTCCAAGATGGTGG - Intronic
1185619940 X:1447757-1447779 GCGGTGTGTGTCCAAGATGGTGG - Intronic
1185619946 X:1447795-1447817 GCTGTGTGTGTCCAAGATGGTGG - Intronic
1185619969 X:1447961-1447983 GCGGTGTGTGTCCAAGATGGTGG - Intronic
1185619975 X:1447999-1448021 ATGGTGTGTGTCCAAGATGGTGG - Intronic
1185619983 X:1448053-1448075 ATGGTGTGTGTCCAAGATGGTGG - Intronic
1185619990 X:1448107-1448129 ATGGTGTGTGTCCAAGATGGTGG - Intronic
1185619998 X:1448161-1448183 GCGGTGTGTGTCCAAGATGGTGG - Intronic
1185620004 X:1448199-1448221 ATGGTGTGTGTCCAAGATGGTGG - Intronic
1185620018 X:1448307-1448329 ATGGTGTGTGTCCAAGATGGTGG - Intronic
1185620036 X:1448414-1448436 GTGGTGTGTATCCAAGATGGTGG - Intronic
1185620048 X:1448506-1448528 GCGGCATGTGTCCAAGATGGTGG - Intronic
1185620051 X:1448525-1448547 GCAGTGTGTGTCCAAGATGGCGG - Intronic
1185620056 X:1448563-1448585 ATGGTGTGTGTCCAAGATGGTGG - Intronic
1185620064 X:1448617-1448639 GCGGTGTGTGTCCAAGATGGTGG - Intronic
1185620077 X:1448709-1448731 ATGGTGTGTGTCCAAGATGGTGG - Intronic
1185620086 X:1448763-1448785 GCGGTGTGTGTCCAAGATGGTGG - Intronic
1185620098 X:1448858-1448880 GCGGTGTGTGTCCAAGATGGTGG - Intronic
1187552399 X:20319049-20319071 GTGGGCTGTGTCAATGATGGTGG - Intergenic
1190122733 X:47675932-47675954 GCGGTGTTTGTCCAAGATGACGG - Intergenic
1190844933 X:54182904-54182926 GCTGCGCTTGGCCATGATGGTGG + Exonic
1196010439 X:110881170-110881192 GATGTGTGTGTCCATGATGGTGG - Intergenic