ID: 1185619255

View in Genome Browser
Species Human (GRCh38)
Location X:1443373-1443395
Sequence ATGGCGGCGTGTGTCCATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 7, 2: 24, 3: 32, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619255_1185619262 20 Left 1185619255 X:1443373-1443395 CCATCATGGACACACGCCGCCAT 0: 1
1: 7
2: 24
3: 32
4: 114
Right 1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG 0: 17
1: 19
2: 26
3: 16
4: 133
1185619255_1185619259 1 Left 1185619255 X:1443373-1443395 CCATCATGGACACACGCCGCCAT 0: 1
1: 7
2: 24
3: 32
4: 114
Right 1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG 0: 1
1: 20
2: 20
3: 25
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619255 Original CRISPR ATGGCGGCGTGTGTCCATGA TGG (reversed) Intronic
901412699 1:9095619-9095641 ATGGCGGTGTTTGTTCAAGATGG - Intergenic
902093217 1:13920898-13920920 ATGGTGGTGTTTGTCCAAGATGG + Intergenic
905464868 1:38145546-38145568 ATGGCAGCATGGGTCCAGGAGGG - Intergenic
908737223 1:67289540-67289562 ATGGCAGCGTGGGTCCAGGAGGG - Intergenic
910354436 1:86339812-86339834 ATGGAGGGGTAGGTCCATGAGGG - Intergenic
915253855 1:154610334-154610356 ATGGTGGCATATGCCCATGATGG + Intronic
916553549 1:165873340-165873362 ATGGTAGCTTGTGTCCAAGACGG - Intronic
924199341 1:241642596-241642618 ATGGCAGTGCTTGTCCATGATGG + Intronic
924466624 1:244304326-244304348 AAGAGGGCGTGTGTCCATGTGGG - Intergenic
1062968115 10:1625920-1625942 CTGGAGGCCTGTGTCCATGCAGG - Intronic
1062968128 10:1625983-1626005 GTGGAGGCCTGTGTCCATGCTGG - Intronic
1062968135 10:1626018-1626040 GTGGAGGCCTGTGTCCATGCAGG - Intronic
1062968158 10:1626144-1626166 GTGGAGGCCTGTGTCCATGCAGG - Intronic
1062968171 10:1626207-1626229 GTGGAGGCCTGTGTCCATGCAGG - Intronic
1062968183 10:1626270-1626292 GTGGAGGCCTGTGTCCATGCAGG - Intronic
1062968196 10:1626333-1626355 GTGGAGGCCTGTGTCCATGCAGG - Intronic
1062968209 10:1626396-1626418 GTGGAGGCCTGTGTCCATGCAGG - Intronic
1062972681 10:1660839-1660861 ATGGTGGCGTTTGTCCAAGATGG - Intronic
1063114216 10:3062464-3062486 ATGGCTGAGTGTGTGAATGAGGG - Intergenic
1063532030 10:6842544-6842566 ATGGTGGTGTTTGTCCAAGATGG - Intergenic
1063604556 10:7510836-7510858 ATGGCAGTGTTTGTCCAAGATGG + Intergenic
1076281383 10:129249577-129249599 ATGGAGGGGTGTGTGCATGGAGG + Intergenic
1076281389 10:129249593-129249615 ATGGAGGGGTGTGTGCATGGGGG + Intergenic
1076281402 10:129249639-129249661 ATAGGGGCGTGTGTGCATGGGGG + Intergenic
1076281418 10:129249693-129249715 ATGGAGGGGTGTGTGCATGGAGG + Intergenic
1076281422 10:129249709-129249731 ATGGAGGGGTGTGTGCATGGAGG + Intergenic
1076865999 10:133166651-133166673 GTGTTGGCGTGTGTCCATGTGGG + Intronic
1090661047 11:128881718-128881740 ATGGTTGGGTGTCTCCATGAGGG - Intergenic
1090664250 11:128904496-128904518 ATGGCAGCGTGCGTCCAGGGCGG + Exonic
1091172065 11:133528326-133528348 ATGATGGCGTGAATCCATGATGG + Intronic
1091999405 12:5020081-5020103 AGGGCTTCATGTGTCCATGAAGG - Intergenic
1094601079 12:31909454-31909476 ATGGCAGTGTTTGTCCAAGATGG - Intergenic
1095813966 12:46401131-46401153 ATGTCTGTGTGTGCCCATGAGGG - Intergenic
1102182587 12:110923644-110923666 GTGGGGGTGTGTGTCCCTGAGGG + Intergenic
1103052581 12:117793261-117793283 ATGTTGGCGTGTGTGCATGTTGG - Intronic
1107293955 13:38890101-38890123 ATGGCGGTGTTTGTCTAAGATGG - Intergenic
1107624572 13:42270338-42270360 ATGGCGGTGCTTGTCCAAGATGG - Intergenic
1109153249 13:58871360-58871382 ATTTCTGGGTGTGTCCATGAGGG + Intergenic
1110678412 13:78277998-78278020 ATGGTGGCTAGTGTCCAAGATGG + Intergenic
1113898217 13:113779246-113779268 ATGGTGGTGTTTGTCCAAGATGG + Intronic
1113898939 13:113785208-113785230 ATGGCAGTGTTTGTCCAAGATGG + Intronic
1114435382 14:22702282-22702304 GTGGAGGCGCCTGTCCATGAGGG - Intergenic
1119473359 14:74912671-74912693 ATGGGGGTGTGTGTAAATGAAGG - Intronic
1119871378 14:78020889-78020911 ATGGCCGAATGTGTCCATGCTGG - Intergenic
1122434819 14:101688302-101688324 ATGGTGGCGTTTGTCCAAGATGG - Intergenic
1122767964 14:104084903-104084925 ATGGCGGTGTTTGTCCAAGAAGG + Intergenic
1122967890 14:105139703-105139725 TTGCCTGCGTGTGTCCATGGTGG - Intergenic
1127500261 15:59548334-59548356 ATGGCGGTGTTTGTCCAAGATGG - Intergenic
1128759260 15:70204320-70204342 ATTGCTGGGTGTGTCTATGAGGG + Intergenic
1134877648 16:17716267-17716289 ATGGTGGTGTTTGTCCAAGATGG - Intergenic
1137027932 16:35497109-35497131 ATGGTGGGCTGTGTCCATGTGGG + Intergenic
1143942592 17:10558066-10558088 ATGCTGGCGTGTGTACATGTGGG + Intergenic
1145909630 17:28534960-28534982 ATGGCTGCGGGGGTCCAGGAGGG - Exonic
1146742329 17:35297656-35297678 ATGGTGGTGTTTGTCCAAGATGG - Intergenic
1153366331 18:4261124-4261146 AAGGCAGAGTATGTCCATGATGG + Intronic
1157863109 18:51159386-51159408 ATGGTGGCGTGAGTCCAGGCCGG + Intergenic
1162433834 19:10644802-10644824 CTGGGGGCGTGTGTCCAGGATGG - Intergenic
1165597223 19:37019899-37019921 ATGGCGGTGTTTGTCCAAGATGG - Intronic
1166598275 19:44071060-44071082 ATGGCAGTGTTTGTCCAAGATGG - Intergenic
1166750629 19:45162563-45162585 GGGGCCGCGTGTGTCCATGGGGG + Intronic
1168099073 19:54131433-54131455 ATGACTGCGTGTGTCCAAGGTGG + Exonic
925258035 2:2506674-2506696 ATGGCCGTGCGTGTCCAAGATGG + Intergenic
925258038 2:2506693-2506715 ATGGCAGTGTGTGTCCAAGATGG + Intergenic
925759907 2:7174587-7174609 ATTTCTGGGTGTGTCCATGAGGG + Intergenic
925988404 2:9234448-9234470 ATGGCGGCGCGTGGCCTTGCAGG + Intronic
926114333 2:10202782-10202804 ATGGCAGTGTTTGTCCAAGATGG + Intronic
926192379 2:10738528-10738550 ATGGAGCCGTGGGTCCCTGAAGG - Intronic
938225899 2:129616121-129616143 ATGGCAGTGTTTGTCCAAGATGG - Intergenic
938586046 2:132691592-132691614 ATGGCGGTGCTTGTCCAAGATGG - Intronic
940106519 2:150107059-150107081 ATGGCTACATGAGTCCATGATGG - Intergenic
944972642 2:205011617-205011639 ATGGCAGCCTGTCTCCAAGACGG - Intronic
946595593 2:221302563-221302585 ATGTCGGAGTGTGTCCTTGAGGG + Intergenic
1172844056 20:37919309-37919331 ATGGAGGTGTGAGTTCATGAAGG - Intronic
1176177179 20:63734253-63734275 ATGGCGGGCTGAGTCCAGGAGGG + Intronic
1176198144 20:63847470-63847492 GTGCCTGTGTGTGTCCATGAAGG - Intergenic
1177337389 21:19748742-19748764 ATGGTGGACTGTGTGCATGACGG + Intergenic
1179579190 21:42329352-42329374 ATGGCGGTGCTTGTCCAAGATGG - Intergenic
957051605 3:75416121-75416143 ATGGCGGGGTGGGGGCATGAAGG - Intergenic
962204376 3:133422973-133422995 ATGACAGGGTGTGTCCAAGAAGG - Intronic
965063327 3:163809585-163809607 ATGGGGGCGTTTGTGCAAGATGG - Intergenic
966537641 3:181052267-181052289 ATGGCGGTGCTTGTCCAAGATGG - Intergenic
969095713 4:4731127-4731149 CTGACGACATGTGTCCATGATGG + Intergenic
969435473 4:7186736-7186758 ACCACGGCGTGAGTCCATGAGGG + Intergenic
972382623 4:38533654-38533676 GTTCCGGCGTGTGTCCGTGAGGG + Intergenic
979084340 4:116388116-116388138 ATGGTGGTGTTTGTCCAAGATGG - Intergenic
980920839 4:139084168-139084190 ATGGCGACGTCTCTGCATGAGGG - Intronic
982793155 4:159615738-159615760 ATGGCGGTGCTTGTCCAAGATGG + Intergenic
984985445 4:185324746-185324768 ATGGCGGTGCTTGTCCAGGATGG + Intronic
984986075 4:185330453-185330475 ATGGCGGTGCTTGTCCAAGATGG + Intronic
994817126 5:104598260-104598282 ATGGCAGTGTTTGTCCAAGATGG - Intergenic
1010479101 6:76328034-76328056 ATGGCGGTGTTTGTCCAAGATGG - Intergenic
1010563740 6:77383434-77383456 ATGGCAGCGCTTGTCCAAGATGG + Intergenic
1011630557 6:89319948-89319970 ATGGTGGTGTTTGTCCAAGATGG - Intergenic
1016219863 6:141655030-141655052 ATGGCAGCGTGGGTCCAGGAGGG - Intergenic
1019144593 6:169968668-169968690 ATGGCAGTGTGTGTCCAGGATGG + Intergenic
1023083905 7:36550865-36550887 AGGGCAGCGTGTAGCCATGAAGG + Intronic
1023604471 7:41916514-41916536 ATGCCGGCTTGTGTGCATGTGGG + Intergenic
1026146980 7:67754962-67754984 ATGGTGGTGTGTGTCCAAGATGG + Intergenic
1031412659 7:121458120-121458142 ATTCCTGGGTGTGTCCATGAGGG - Intergenic
1034051702 7:147990698-147990720 ATGGCGGTGCTTGTCCAAGATGG + Intronic
1036575813 8:10026878-10026900 ATGGCGGTGCTTGTCCAAGATGG + Intergenic
1037721044 8:21444303-21444325 ATGCCAGCATATGTCCATGAAGG + Intergenic
1042936028 8:74059129-74059151 ATTGCTGGGTGTGTCTATGAGGG - Intergenic
1046028568 8:108755032-108755054 ATTTCTGGGTGTGTCCATGAGGG - Intronic
1049281035 8:141744801-141744823 ATTCCTGGGTGTGTCCATGAGGG + Intergenic
1050447396 9:5739704-5739726 ATGGCAGCATGGGTCCAGGAGGG + Intronic
1053265970 9:36713910-36713932 ATGGCTGCGTGTCTGCAGGACGG + Intergenic
1053456803 9:38239290-38239312 ATTTCTGGGTGTGTCCATGAAGG + Intergenic
1053484776 9:38443453-38443475 AGGGGGCCGTCTGTCCATGAAGG - Intergenic
1054854469 9:69883527-69883549 ATGGTGGTGTTTGTCCAAGATGG + Intronic
1061589442 9:131589143-131589165 ATGGCTGCCTGTGTCCTTGGAGG + Intronic
1185619199 X:1442993-1443015 ATGGCGGTGTGTGTCCAAGATGG - Intronic
1185619208 X:1443050-1443072 ACGACGGTGTGTGTCCACGATGG - Intronic
1185619218 X:1443126-1443148 ATGGCGGCGTGTGTCCACGACGG - Intronic
1185619221 X:1443145-1443167 ATGGCGGTGTGTGTCCAAGATGG - Intronic
1185619224 X:1443164-1443186 ATGGCGGTGTGTGTCCACGATGG - Intronic
1185619227 X:1443183-1443205 ATGGCAGTGTGTGTCCACGATGG - Intronic
1185619234 X:1443240-1443262 ACGGCGGCGTGTGTCCACGACGG - Intronic
1185619237 X:1443259-1443281 ATGGCGGTGTGTGTCCAAGACGG - Intronic
1185619240 X:1443278-1443300 ATGGCGGTGTGTGTCCATGATGG - Intronic
1185619243 X:1443297-1443319 ATGGCGGTGTGTGTCCAAGATGG - Intronic
1185619246 X:1443316-1443338 ATGGCGGTGTGTGTCCAAGATGG - Intronic
1185619249 X:1443335-1443357 ATGGCGGTGTCTGTCCAAGATGG - Intronic
1185619252 X:1443354-1443376 ATGGTGGTGTGTGTCCAAGATGG - Intronic
1185619255 X:1443373-1443395 ATGGCGGCGTGTGTCCATGATGG - Intronic
1185619258 X:1443392-1443414 ATGGCGGCGTGTGTCCAAGATGG - Intronic
1185619261 X:1443411-1443433 ATGGCGGTGTGTGTCCAAGATGG - Intronic
1185619264 X:1443430-1443452 ATGGCGGTGTCTGTCCAAGATGG - Intronic
1185619267 X:1443449-1443471 ATGGTGGTGTGTGTCCAAGATGG - Intronic
1185619270 X:1443468-1443490 ATGGCGGCATGTGTCCACGATGG - Intronic
1185619279 X:1443532-1443554 ATGGAGGTGTCTGTCCAAGATGG - Intronic
1185619282 X:1443551-1443573 ATGGCGGTGTGTGTCCAAGATGG - Intronic
1185619285 X:1443570-1443592 ATGGCGGTGTGTGTCCATGATGG - Intronic
1185619288 X:1443589-1443611 ATGGCGGTGTCTGTCCAAGATGG - Intronic
1185619291 X:1443608-1443630 ATGGCGGTGTCTGTCCACGATGG - Intronic
1185619294 X:1443627-1443649 ATGGCGGTGTCTGTCCACGATGG - Intronic
1185619297 X:1443646-1443668 ATGGCGGTGTGTGTCCATGATGG - Intronic
1185619300 X:1443665-1443687 ATGGCGGTGTGTGTCCATGATGG - Intronic
1185619303 X:1443684-1443706 ATGGCAGTGTGTGTCCACGATGG - Intronic
1185619307 X:1443712-1443734 ATGGGGGTGTGTGTCCACGATGG - Intronic
1185619317 X:1443775-1443797 ATGGGGGTGTGTGTCCACGATGG - Intronic
1185619324 X:1443810-1443832 ATGGCGGTGTGTGTCCACGATGG - Intronic
1185619329 X:1443838-1443860 ATGGTGGTGTGTGTCCTCGATGG - Intronic
1185619332 X:1443857-1443879 ACGGCGGTGTCTGTCCACGATGG - Intronic
1185619335 X:1443876-1443898 ATGGGGGTGTCTGTCCACGACGG - Intronic
1185619340 X:1443895-1443917 ATGGCGGTGTGTGTCCATGATGG - Intronic
1185619348 X:1443933-1443955 ATGGCAGTGTCTGTCCAAGACGG - Intronic
1185619869 X:1447265-1447287 ATGGCAGTGTGTGTCGAAGATGG - Intronic
1185619875 X:1447303-1447325 ATGGCGGTGTGTGTCCAAGATGG - Intronic
1185619888 X:1447395-1447417 ATGGCAGTGTGTGTCCAAGATGG - Intronic
1185619896 X:1447449-1447471 ATGGCCGTGTGTGTCCAAGATGG - Intronic
1185619901 X:1447487-1447509 ATGGCGGTGTGTGTCCAAGATGG - Intronic
1185619911 X:1447541-1447563 ATGGCCGTGTGTGTCCAAGATGG - Intronic
1185619918 X:1447595-1447617 ATGGCGGTGTGTGTCCAAGATGG - Intronic
1185619926 X:1447649-1447671 ATGGCGGTGTGTGTCCAAGATGG - Intronic
1185619938 X:1447741-1447763 ATGGTGGTGTGTGTCAAAGATGG - Intronic
1185619941 X:1447760-1447782 ATGGCGGTGTGTGTCCAAGATGG - Intronic
1185619947 X:1447798-1447820 ATAGCTGTGTGTGTCCAAGATGG - Intronic
1185619953 X:1447852-1447874 ATGGCAGTGTGTGTCCCAGATGG - Intronic
1185619959 X:1447890-1447912 ATGGCGGTGCTTGTCCAAGATGG - Intronic
1185619970 X:1447964-1447986 ATGGCGGTGTGTGTCCAAGATGG - Intronic
1185619978 X:1448018-1448040 ATGGCGGTGTGTGTCCAAGATGG - Intronic
1185619986 X:1448072-1448094 ATGGCTGTGTGTGTCCAAGATGG - Intronic
1185619993 X:1448126-1448148 ATGGCGGTGTGTGTCCAAGATGG - Intronic
1185619999 X:1448164-1448186 ATGGCGGTGTGTGTCCAAGATGG - Intronic
1185620007 X:1448218-1448240 ATGGCAGTGTGTGTCCAAGATGG - Intronic
1185620022 X:1448326-1448348 ATGGCAGTGTGTGTCCCAGATGG - Intronic
1185620037 X:1448417-1448439 ATGGTGGTGTGTATCCAAGATGG - Intronic
1185620049 X:1448509-1448531 ATGGCGGCATGTGTCCAAGATGG - Intronic
1185620052 X:1448528-1448550 ATGGCAGTGTGTGTCCAAGATGG - Intronic
1185620060 X:1448582-1448604 ATGGCCGTGTGTGTCCAAGATGG - Intronic
1185620065 X:1448620-1448642 ATGGCGGTGTGTGTCCAAGATGG - Intronic
1185620073 X:1448674-1448696 ATGGCAGTGTGTGTCCAAGATGG - Intronic
1185620081 X:1448728-1448750 ATGGTGGTGTGTGTCCCAGATGG - Intronic
1185620087 X:1448766-1448788 ATGGCGGTGTGTGTCCAAGATGG - Intronic
1185620099 X:1448861-1448883 ATGGCGGTGTGTGTCCAAGATGG - Intronic
1187964484 X:24597091-24597113 AAGTCTGTGTGTGTCCATGAGGG - Intronic
1196167900 X:112555498-112555520 CTGGTGGCGTGTGCTCATGAAGG - Intergenic