ID: 1185619259

View in Genome Browser
Species Human (GRCh38)
Location X:1443397-1443419
Sequence TTGGACACACGCCGCCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 20, 2: 20, 3: 25, 4: 51}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619255_1185619259 1 Left 1185619255 X:1443373-1443395 CCATCATGGACACACGCCGCCAT 0: 1
1: 7
2: 24
3: 32
4: 114
Right 1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG 0: 1
1: 20
2: 20
3: 25
4: 51
1185619251_1185619259 23 Left 1185619251 X:1443351-1443373 CCGCCATCTTGGACACACACCAC 0: 2
1: 24
2: 37
3: 58
4: 256
Right 1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG 0: 1
1: 20
2: 20
3: 25
4: 51
1185619254_1185619259 4 Left 1185619254 X:1443370-1443392 CCACCATCATGGACACACGCCGC 0: 1
1: 6
2: 17
3: 23
4: 90
Right 1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG 0: 1
1: 20
2: 20
3: 25
4: 51
1185619252_1185619259 20 Left 1185619252 X:1443354-1443376 CCATCTTGGACACACACCACCAT 0: 3
1: 30
2: 68
3: 114
4: 251
Right 1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG 0: 1
1: 20
2: 20
3: 25
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619259 Original CRISPR TTGGACACACGCCGCCATCT TGG Intronic
906137567 1:43510266-43510288 TTGGACATCCTCTGCCATCTTGG + Intergenic
915253483 1:154607953-154607975 TTGGACCTTCGCCGCCGTCTGGG - Intronic
1063377268 10:5561810-5561832 TTGGAGTCACTCTGCCATCTTGG - Intergenic
1070415847 10:76188544-76188566 TTAGACACATTCCACCATCTGGG - Intronic
1075383146 10:122035065-122035087 TTGGAGACAAGAAGCCATCTTGG + Intronic
1098472249 12:70858716-70858738 TTGGACACTCGGCTTCATCTAGG - Intronic
1100717571 12:97322087-97322109 TAGGACACACACAGCCCTCTTGG - Intergenic
1109164068 13:59011258-59011280 TTGACCACACGCAGCCACCTTGG + Intergenic
1118710812 14:68518097-68518119 TTGAACAAACGCTGCCTTCTGGG - Intronic
1144492448 17:15725389-15725411 TTGGCCACAGGCGGGCATCTGGG - Intergenic
1144908026 17:18653798-18653820 TTGGCCACAGGCGGGCATCTGGG + Intronic
1147383110 17:40067244-40067266 TGGGACACACCCCACCAGCTAGG + Intronic
1148496822 17:48058040-48058062 TTGGCCAGACTCCCCCATCTTGG - Intronic
1149784824 17:59425888-59425910 TTAGACACATGCTGTCATCTGGG - Intergenic
1153837498 18:8977094-8977116 TTGGCCACACCCGGCCACCTTGG - Intergenic
1155542592 18:26884051-26884073 GTGGACACCCCCCGCCATATGGG - Intergenic
1155542615 18:26884129-26884151 CTGGACACCCTCCGCCATATGGG - Intergenic
1161698361 19:5782621-5782643 TTGGAGACACACAGCCATCAGGG - Intergenic
1162772432 19:12957195-12957217 TCGCACGGACGCCGCCATCTTGG + Exonic
1165361860 19:35341707-35341729 ATGGACACACGCAGCCTCCTGGG - Exonic
1168099071 19:54131428-54131450 TTGGACACACGCAGTCATTCAGG - Exonic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
943654064 2:190488658-190488680 AGTGACACACGCGGCCATCTGGG + Exonic
946903739 2:224396449-224396471 CTGCACACACGCCTCCATCCTGG + Intronic
948388784 2:237597770-237597792 TTGGACACAGGCCTCCATCCAGG + Intronic
1175760868 20:61561477-61561499 TTGGACACACGCAGGCCACTTGG - Intronic
1178597318 21:33966552-33966574 TTGGACACACGCCCCTCCCTTGG + Intergenic
1185105953 22:48869967-48869989 TGGTGCACACGCAGCCATCTTGG + Intergenic
961170323 3:124793255-124793277 ATGGACACACGCAGGCTTCTAGG + Intronic
1006076392 6:31535250-31535272 TTGGGCACAAGCCGCCTTCTTGG + Intronic
1007407469 6:41643291-41643313 CTTGACACACTCAGCCATCTGGG + Intronic
1009366367 6:62860814-62860836 GTGGACACTCCCCGCCATATGGG - Intergenic
1009366415 6:62860974-62860996 GTGGACACCCCCCGCCATATGGG - Intergenic
1009366438 6:62861055-62861077 GTGGACACCCCCCGCCATATGGG - Intergenic
1016472907 6:144393604-144393626 CATGACACAGGCCGCCATCTTGG - Intronic
1020335591 7:7059918-7059940 GTGGACACACCTCGCCATATAGG + Intergenic
1026482220 7:70789415-70789437 TTGACCACATGCAGCCATCTTGG + Intronic
1036662382 8:10716522-10716544 TGGGACACCCGCCGCCTACTAGG + Intergenic
1038637661 8:29300550-29300572 TTGTACACACCCCGCGATATGGG + Intergenic
1043483844 8:80679410-80679432 TTGGACCCATGCAGCAATCTGGG - Intronic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619203 X:1443017-1443039 TTGGAGAGACACCACCATCTTGG + Intronic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619216 X:1443112-1443134 GTGGACACACACCGCCGTCGTGG + Intronic
1185619219 X:1443131-1443153 GTGGACACACGCCGCCATCTTGG + Intronic
1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG + Intronic
1185619225 X:1443169-1443191 GTGGACACACACCGCCATCGTGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619235 X:1443245-1443267 GTGGACACACGCCGCCGTCTTGG + Intronic
1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619256 X:1443378-1443400 ATGGACACACGCCGCCATCTTGG + Intronic
1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic
1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG + Intronic
1185619271 X:1443473-1443495 GTGGACACATGCCGCCATCTTGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG + Intronic
1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619289 X:1443594-1443616 TTGGACAGACACCGCCATCGTGG + Intronic
1185619292 X:1443613-1443635 GTGGACAGACACCGCCATCGTGG + Intronic
1185619295 X:1443632-1443654 GTGGACAGACACCGCCATCATGG + Intronic
1185619298 X:1443651-1443673 ATGGACACACACCGCCATCATGG + Intronic
1185619301 X:1443670-1443692 ATGGACACACACCGCCATCGTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619308 X:1443717-1443739 GTGGACACACACCCCCATCGTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619318 X:1443780-1443802 GTGGACACACACCCCCATCGTGG + Intronic
1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619344 X:1443919-1443941 TTGGACAGACACCCCCGTCTTGG + Intronic
1185619349 X:1443938-1443960 TTGGACAGACACTGCCATGTTGG + Intronic
1185619870 X:1447270-1447292 TTCGACACACACTGCCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619884 X:1447362-1447384 TTGGACACACATGGCCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619897 X:1447454-1447476 TTGGACACACACGGCCATGTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619912 X:1447546-1447568 TTGGACACACACGGCCATCTTGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619935 X:1447708-1447730 TTGGACAAGCACTGCCATCTTGG + Intronic
1185619939 X:1447746-1447768 TTTGACACACACCACCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619948 X:1447803-1447825 TTGGACACACACAGCTATCTTGG + Intronic
1185619954 X:1447857-1447879 TGGGACACACACTGCCATCTTGG + Intronic
1185619960 X:1447895-1447917 TTGGACAAGCACCGCCATCTTGG + Intronic
1185619966 X:1447931-1447953 TTGGATACACAACACCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620023 X:1448331-1448353 TGGGACACACACTGCCATCTTGG + Intronic
1185620029 X:1448369-1448391 TTGGACAAGCACCACCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620050 X:1448514-1448536 TTGGACACATGCCGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620094 X:1448809-1448831 TTGGACAAGCACTGCCATCTTGG + Intronic
1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1197893266 X:131286371-131286393 ATGGAGACACGCCAGCATCTTGG + Intronic
1200992042 Y:9355429-9355451 TCCGACCCACGCCGACATCTCGG + Intergenic