ID: 1185619260 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:1443408-1443430 |
| Sequence | GCGGTGTGTGTCCAAGATGG CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1185619260_1185619265 | 4 | Left | 1185619260 | X:1443408-1443430 | CCGCCATCTTGGACACACACCGC | No data | ||
| Right | 1185619265 | X:1443435-1443457 | TTGGACAGACACCGCCATCTTGG | 0: 2 1: 19 2: 23 3: 33 4: 95 |
||||
| 1185619260_1185619268 | 23 | Left | 1185619260 | X:1443408-1443430 | CCGCCATCTTGGACACACACCGC | No data | ||
| Right | 1185619268 | X:1443454-1443476 | TTGGACACACACCACCATCGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1185619260 | Original CRISPR | GCGGTGTGTGTCCAAGATGG CGG (reversed) | Intronic | ||