ID: 1185619260 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:1443408-1443430 |
Sequence | GCGGTGTGTGTCCAAGATGG CGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1185619260_1185619265 | 4 | Left | 1185619260 | X:1443408-1443430 | CCGCCATCTTGGACACACACCGC | No data | ||
Right | 1185619265 | X:1443435-1443457 | TTGGACAGACACCGCCATCTTGG | No data | ||||
1185619260_1185619268 | 23 | Left | 1185619260 | X:1443408-1443430 | CCGCCATCTTGGACACACACCGC | No data | ||
Right | 1185619268 | X:1443454-1443476 | TTGGACACACACCACCATCGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1185619260 | Original CRISPR | GCGGTGTGTGTCCAAGATGG CGG (reversed) | Intronic | ||