ID: 1185619261

View in Genome Browser
Species Human (GRCh38)
Location X:1443411-1443433
Sequence ATGGCGGTGTGTGTCCAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619261_1185619265 1 Left 1185619261 X:1443411-1443433 CCATCTTGGACACACACCGCCAT No data
Right 1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG No data
1185619261_1185619268 20 Left 1185619261 X:1443411-1443433 CCATCTTGGACACACACCGCCAT No data
Right 1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619261 Original CRISPR ATGGCGGTGTGTGTCCAAGA TGG (reversed) Intronic