ID: 1185619263

View in Genome Browser
Species Human (GRCh38)
Location X:1443427-1443449
Sequence GCGGTGTCTGTCCAAGATGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619263_1185619268 4 Left 1185619263 X:1443427-1443449 CCGCCATCTTGGACAGACACCGC No data
Right 1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG No data
1185619263_1185619271 23 Left 1185619263 X:1443427-1443449 CCGCCATCTTGGACAGACACCGC No data
Right 1185619271 X:1443473-1443495 GTGGACACATGCCGCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619263 Original CRISPR GCGGTGTCTGTCCAAGATGG CGG (reversed) Intronic