ID: 1185619264

View in Genome Browser
Species Human (GRCh38)
Location X:1443430-1443452
Sequence ATGGCGGTGTCTGTCCAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619264_1185619271 20 Left 1185619264 X:1443430-1443452 CCATCTTGGACAGACACCGCCAT No data
Right 1185619271 X:1443473-1443495 GTGGACACATGCCGCCATCTTGG No data
1185619264_1185619272 29 Left 1185619264 X:1443430-1443452 CCATCTTGGACAGACACCGCCAT No data
Right 1185619272 X:1443482-1443504 TGCCGCCATCTTGGCCATCATGG No data
1185619264_1185619268 1 Left 1185619264 X:1443430-1443452 CCATCTTGGACAGACACCGCCAT No data
Right 1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619264 Original CRISPR ATGGCGGTGTCTGTCCAAGA TGG (reversed) Intronic