ID: 1185619265

View in Genome Browser
Species Human (GRCh38)
Location X:1443435-1443457
Sequence TTGGACAGACACCGCCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619258_1185619265 20 Left 1185619258 X:1443392-1443414 CCATCTTGGACACACGCCGCCAT No data
Right 1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG No data
1185619260_1185619265 4 Left 1185619260 X:1443408-1443430 CCGCCATCTTGGACACACACCGC No data
Right 1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG No data
1185619257_1185619265 23 Left 1185619257 X:1443389-1443411 CCGCCATCTTGGACACACGCCGC No data
Right 1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG No data
1185619261_1185619265 1 Left 1185619261 X:1443411-1443433 CCATCTTGGACACACACCGCCAT No data
Right 1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619265 Original CRISPR TTGGACAGACACCGCCATCT TGG Intronic