ID: 1185619265

View in Genome Browser
Species Human (GRCh38)
Location X:1443435-1443457
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 2, 1: 19, 2: 23, 3: 33, 4: 95}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619260_1185619265 4 Left 1185619260 X:1443408-1443430 CCGCCATCTTGGACACACACCGC 0: 12
1: 16
2: 28
3: 56
4: 201
Right 1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG 0: 2
1: 19
2: 23
3: 33
4: 95
1185619261_1185619265 1 Left 1185619261 X:1443411-1443433 CCATCTTGGACACACACCGCCAT 0: 19
1: 27
2: 46
3: 99
4: 214
Right 1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG 0: 2
1: 19
2: 23
3: 33
4: 95
1185619258_1185619265 20 Left 1185619258 X:1443392-1443414 CCATCTTGGACACACGCCGCCAT 0: 1
1: 22
2: 30
3: 53
4: 150
Right 1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG 0: 2
1: 19
2: 23
3: 33
4: 95
1185619257_1185619265 23 Left 1185619257 X:1443389-1443411 CCGCCATCTTGGACACACGCCGC 0: 1
1: 14
2: 18
3: 32
4: 139
Right 1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG 0: 2
1: 19
2: 23
3: 33
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906137567 1:43510266-43510288 TTGGACATCCTCTGCCATCTTGG + Intergenic
908647947 1:66300036-66300058 TTGCACAAACACAGACATCTAGG + Intronic
912711759 1:111954951-111954973 TAAGACAGACAGCTCCATCTAGG - Intronic
922289661 1:224199763-224199785 TTGAACAGACAGCACCGTCTGGG + Intergenic
922963365 1:229666863-229666885 TTGGACAGACACCTGCAGCAGGG + Intergenic
1063123607 10:3122185-3122207 TTGGCCAGGCACAGCCACCTTGG + Intronic
1073583401 10:104687189-104687211 TTGGAAAGACAAGGCCACCTTGG - Intronic
1075192984 10:120328571-120328593 TTGGACATAAACAGCAATCTAGG - Intergenic
1081085299 11:38792108-38792130 AGGGACAGACAACACCATCTAGG + Intergenic
1090412561 11:126519142-126519164 ATGGCCTGACACCGCCCTCTGGG - Intronic
1092247112 12:6869823-6869845 TTGGACAGACACAGCCCACATGG + Intronic
1093930299 12:24949185-24949207 TGGGAGAGACTCCACCATCTGGG - Intronic
1094212222 12:27904662-27904684 AAGGACAGACACCCCCAACTTGG + Intergenic
1095230717 12:39735952-39735974 TTGGAGAAACACTGCCAGCTTGG + Intronic
1098979110 12:76935937-76935959 TTGGCCAGACAAGACCATCTAGG - Intergenic
1100717571 12:97322087-97322109 TAGGACACACACAGCCCTCTTGG - Intergenic
1108355456 13:49625475-49625497 TGAGACAGGCACCGCCATCAAGG - Intergenic
1111584986 13:90272187-90272209 TTGGACAGAAATCATCATCTGGG - Intergenic
1113345997 13:109479201-109479223 TAAGCCAGACACCCCCATCTTGG + Intergenic
1114948233 14:27714459-27714481 TTAGACAGACACCTCCTTATTGG - Intergenic
1127958581 15:63873882-63873904 TGGTACAGACACCCCCAACTAGG + Intergenic
1128186163 15:65645001-65645023 TGGGACAGCCACTGCCATGTGGG + Intronic
1131556978 15:93408148-93408170 TTGGAGAGACACCGGCAACAGGG + Intergenic
1138128750 16:54460515-54460537 GTGGACAGACAGAGCCAGCTAGG + Intergenic
1141789460 16:86224508-86224530 TGTGACAGACACCCCCATTTTGG - Intergenic
1144495240 17:15741601-15741623 ATGGGCAGACACTTCCATCTTGG - Intronic
1144638992 17:16927296-16927318 ATGGGCAGACATTGCCATCTTGG + Intergenic
1144921478 17:18767870-18767892 TGGGACAGACACTACCTTCTTGG - Intronic
1146054035 17:29572459-29572481 TTGAACAGACACAGCCCCCTGGG - Exonic
1148496822 17:48058040-48058062 TTGGCCAGACTCCCCCATCTTGG - Intronic
1148857650 17:50587533-50587555 TTGGACAGACCTGGCTATCTGGG + Intronic
1149948715 17:60960819-60960841 CTGCAGAAACACCGCCATCTTGG - Intronic
1151578515 17:74964572-74964594 CTGGGCAGACACAGCCACCTCGG - Exonic
1152420295 17:80189194-80189216 CTGGAAAGACTCCGCCCTCTGGG + Intronic
1161698361 19:5782621-5782643 TTGGAGACACACAGCCATCAGGG - Intergenic
1162772432 19:12957195-12957217 TCGCACGGACGCCGCCATCTTGG + Exonic
1168057050 19:53869701-53869723 TTGGACAGGCTCCTCCCTCTAGG - Intronic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
942142680 2:172993721-172993743 CTGGCCAGACACAGCCCTCTGGG - Intronic
944663292 2:201938918-201938940 TGGAACAGAGACCGCCATCTCGG + Intergenic
1174046807 20:47739531-47739553 TTGATCAGACACCACCTTCTTGG + Intronic
1177779470 21:25607345-25607367 CTAGACAGACACCACTATCTAGG + Intronic
1181626218 22:24124008-24124030 TTGGAAAGAAACCGCCTTCAGGG + Intronic
1181788170 22:25242684-25242706 TTGGACAGAAACTGCTATCTCGG - Intergenic
1182452436 22:30429432-30429454 TGGGGCTGACACCACCATCTTGG - Intergenic
965779697 3:172271866-172271888 AAGGATAGACACTGCCATCTTGG + Intronic
969639232 4:8387119-8387141 TTGGACAGGAACCGCCCTCGAGG - Intronic
973966259 4:56165028-56165050 ATGGCCAGAAACTGCCATCTGGG - Intergenic
976671254 4:87656620-87656642 TGGAACATACACAGCCATCTTGG - Intronic
982448220 4:155519995-155520017 TTGCACAAACAGTGCCATCTAGG - Intergenic
988995060 5:36706807-36706829 TTGGAGAACCACTGCCATCTGGG - Intergenic
997661898 5:135595403-135595425 ATGGACAGGCACCGCCAACCAGG + Intergenic
1000015228 5:157269808-157269830 TTGTACAGACAAGGCCATCCAGG - Intronic
1000229818 5:159305232-159305254 TTGGACAGCCATCCCCAGCTTGG + Intergenic
1003286978 6:4742933-4742955 TTGGACAGAAACCTCAAGCTTGG - Intronic
1004454603 6:15780276-15780298 TTGGAAAGACACCATCATCCTGG - Intergenic
1010917455 6:81637861-81637883 TTGCACTTACACCACCATCTTGG + Intronic
1014923896 6:127247689-127247711 ATGGACAGTCACGGCCAGCTGGG + Intergenic
1020650929 7:10875262-10875284 CTGGACAGACACTGGCAGCTAGG - Intergenic
1031199366 7:118660239-118660261 TTGAATAGTCACTGCCATCTTGG - Intergenic
1035218512 7:157390121-157390143 TGGGACAGCAACCACCATCTGGG - Intronic
1044585788 8:93868324-93868346 TTGGACAGCCAACACCATTTTGG - Intronic
1054813304 9:69451814-69451836 TTGTACAAACACTGCAATCTAGG - Intronic
1057287762 9:93774223-93774245 CAGCACAGACACTGCCATCTTGG + Intergenic
1059876465 9:118640957-118640979 TTGGAGAGACAAGGCCAACTTGG + Intergenic
1061398562 9:130356234-130356256 ATGCACAGACACCTCCACCTCGG - Intronic
1061782042 9:133001908-133001930 TTGGTCAGACACTGCCCTCTGGG + Intergenic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619203 X:1443017-1443039 TTGGAGAGACACCACCATCTTGG + Intronic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619216 X:1443112-1443134 GTGGACACACACCGCCGTCGTGG + Intronic
1185619219 X:1443131-1443153 GTGGACACACGCCGCCATCTTGG + Intronic
1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG + Intronic
1185619225 X:1443169-1443191 GTGGACACACACCGCCATCGTGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619235 X:1443245-1443267 GTGGACACACGCCGCCGTCTTGG + Intronic
1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619256 X:1443378-1443400 ATGGACACACGCCGCCATCTTGG + Intronic
1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic
1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG + Intronic
1185619271 X:1443473-1443495 GTGGACACATGCCGCCATCTTGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG + Intronic
1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619289 X:1443594-1443616 TTGGACAGACACCGCCATCGTGG + Intronic
1185619292 X:1443613-1443635 GTGGACAGACACCGCCATCGTGG + Intronic
1185619295 X:1443632-1443654 GTGGACAGACACCGCCATCATGG + Intronic
1185619298 X:1443651-1443673 ATGGACACACACCGCCATCATGG + Intronic
1185619301 X:1443670-1443692 ATGGACACACACCGCCATCGTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619308 X:1443717-1443739 GTGGACACACACCCCCATCGTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619318 X:1443780-1443802 GTGGACACACACCCCCATCGTGG + Intronic
1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG + Intronic
1185619333 X:1443862-1443884 GTGGACAGACACCGCCGTCGTGG + Intronic
1185619336 X:1443881-1443903 GTGGACAGACACCCCCATCATGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619344 X:1443919-1443941 TTGGACAGACACCCCCGTCTTGG + Intronic
1185619349 X:1443938-1443960 TTGGACAGACACTGCCATGTTGG + Intronic
1185619870 X:1447270-1447292 TTCGACACACACTGCCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619879 X:1447327-1447349 TTGGATAAGCACCACCATCTTGG + Intronic
1185619884 X:1447362-1447384 TTGGACACACATGGCCATCTTGG + Intronic
1185619886 X:1447381-1447403 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619891 X:1447419-1447441 TTGGATAAGCACCACCATCTTGG + Intronic
1185619897 X:1447454-1447476 TTGGACACACACGGCCATGTTGG + Intronic
1185619899 X:1447473-1447495 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619912 X:1447546-1447568 TTGGACACACACGGCCATCTTGG + Intronic
1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619922 X:1447619-1447641 TTGGATAAGCACCACCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619930 X:1447673-1447695 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619935 X:1447708-1447730 TTGGACAAGCACTGCCATCTTGG + Intronic
1185619939 X:1447746-1447768 TTTGACACACACCACCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619945 X:1447784-1447806 TTGGATAAGCACCACCATCTTGG + Intronic
1185619948 X:1447803-1447825 TTGGACACACACAGCTATCTTGG + Intronic
1185619954 X:1447857-1447879 TGGGACACACACTGCCATCTTGG + Intronic
1185619960 X:1447895-1447917 TTGGACAAGCACCGCCATCTTGG + Intronic
1185619966 X:1447931-1447953 TTGGATACACAACACCATCTTGG + Intronic
1185619968 X:1447950-1447972 TTGGAAAAGCACCACCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185619989 X:1448096-1448118 TTGGATAAGCACCACCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185619997 X:1448150-1448172 TTGGATAAGCACCACCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620003 X:1448188-1448210 TTGGATAAGCACCACCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620010 X:1448242-1448264 TTGGATAAGCACCACCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620017 X:1448296-1448318 TTGGATAAGCACCACCATCTTGG + Intronic
1185620023 X:1448331-1448353 TGGGACACACACTGCCATCTTGG + Intronic
1185620029 X:1448369-1448391 TTGGACAAGCACCACCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185620041 X:1448441-1448463 TTGGAAAAGCACCACCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620047 X:1448495-1448517 TTGGATAAGCACCACCATCTTGG + Intronic
1185620050 X:1448514-1448536 TTGGACACATGCCGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620055 X:1448552-1448574 TTGGATAAGCACCACCATCTTGG + Intronic
1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG + Intronic
1185620063 X:1448606-1448628 TTGGATAAGCACCACCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620069 X:1448644-1448666 TTGGATAAGCACCACCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1185620076 X:1448698-1448720 TTGGAGAAGCACCACCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1185620085 X:1448752-1448774 TTGGATAAGCACCACCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG + Intronic
1185620094 X:1448809-1448831 TTGGACAAGCACTGCCATCTTGG + Intronic
1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1187736015 X:22304253-22304275 TTGGAGAGAGACTGCCATGTTGG + Intergenic
1190217788 X:48491670-48491692 GTGTACAGACACCACAATCTAGG - Intergenic
1195579180 X:106482268-106482290 TTGCCCAGACACCTCCATCTTGG - Intergenic
1199685060 X:150258279-150258301 TGAGACAGACACAGCCTTCTTGG + Intergenic
1200698876 Y:6385445-6385467 TTGTACAGACAGAGCCATCCTGG + Intergenic
1201035236 Y:9779254-9779276 TTGTACAGACAGAGCCATCCTGG - Intergenic