ID: 1185619268

View in Genome Browser
Species Human (GRCh38)
Location X:1443454-1443476
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 2, 2: 30, 3: 30, 4: 114}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619261_1185619268 20 Left 1185619261 X:1443411-1443433 CCATCTTGGACACACACCGCCAT 0: 19
1: 27
2: 46
3: 99
4: 214
Right 1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG 0: 1
1: 2
2: 30
3: 30
4: 114
1185619264_1185619268 1 Left 1185619264 X:1443430-1443452 CCATCTTGGACAGACACCGCCAT 0: 3
1: 27
2: 51
3: 82
4: 185
Right 1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG 0: 1
1: 2
2: 30
3: 30
4: 114
1185619260_1185619268 23 Left 1185619260 X:1443408-1443430 CCGCCATCTTGGACACACACCGC 0: 12
1: 16
2: 28
3: 56
4: 201
Right 1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG 0: 1
1: 2
2: 30
3: 30
4: 114
1185619263_1185619268 4 Left 1185619263 X:1443427-1443449 CCGCCATCTTGGACAGACACCGC 0: 3
1: 17
2: 24
3: 59
4: 153
Right 1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG 0: 1
1: 2
2: 30
3: 30
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902269092 1:15290219-15290241 TGGGACACACACAACCTTCAGGG + Intronic
904048145 1:27621768-27621790 TTGGACACCCCCCACCACTGGGG + Intronic
909411963 1:75364608-75364630 TTGGGAAAACACCACCATCCAGG - Intronic
914933252 1:151953533-151953555 TTGGACACTCACCACCAGACTGG + Intergenic
917557337 1:176103322-176103344 TTGCACACACACCAACCTCCAGG + Intronic
920362543 1:205429314-205429336 TTTGAAACACACCACCAGCGTGG - Intronic
1064467317 10:15597234-15597256 AAGGTCACACACCACCATCCTGG + Exonic
1070415847 10:76188544-76188566 TTAGACACATTCCACCATCTGGG - Intronic
1077197503 11:1288725-1288747 CTGGACCCACATCACCATCCCGG - Exonic
1082044825 11:47716318-47716340 TTGATCACACAGCACCATCTGGG + Intergenic
1089015148 11:115159489-115159511 ATGGACACACACCAGGCTCGAGG + Intergenic
1089937357 11:122377924-122377946 CTGAACACACACCACCACTGGGG + Intergenic
1091481647 12:838554-838576 ATGGACACACACCACCATGCTGG + Intronic
1098379250 12:69851798-69851820 ACAGACACACACCACCATCTTGG + Intronic
1101569535 12:105940478-105940500 TCGAAGACACACCACCATCCTGG + Intergenic
1102282656 12:111630561-111630583 TTGCACACAGTCTACCATCGTGG + Intergenic
1102811458 12:115827696-115827718 TGTGTCACACACCACCATCACGG + Intergenic
1106451210 13:29884237-29884259 TAGGACACACAGGACCATTGTGG + Intergenic
1115489922 14:33949559-33949581 ATGGACATGCACCAACATCGCGG + Intronic
1125550564 15:40541472-40541494 ATGGGCACACACCACCAACCCGG + Intronic
1127327127 15:57906612-57906634 TTGGAAACAGACCACCAACAGGG - Intergenic
1134202709 16:12212100-12212122 CTCGTCACACACCACCACCGAGG - Intronic
1137267962 16:46884324-46884346 TCGCACACCCACCACCGTCGGGG - Intergenic
1144750314 17:17644065-17644087 TTGGACACACACACACATAGAGG + Intergenic
1146453234 17:32991100-32991122 CTGCACACCCACCACCATCCTGG + Intronic
1147383110 17:40067244-40067266 TGGGACACACCCCACCAGCTAGG + Intronic
1154637500 18:16876670-16876692 TGAGACACCCACCACCATCCAGG - Intergenic
1158504859 18:58038195-58038217 TTGGCCACACAGCAGCATCAGGG - Intergenic
1158591390 18:58781807-58781829 TTATACACACACCACCACCAAGG - Intergenic
1160389596 18:78520142-78520164 TTGGACGCAGCCCACCATCCAGG - Intergenic
1161698361 19:5782621-5782643 TTGGAGACACACAGCCATCAGGG - Intergenic
1165286457 19:34846728-34846750 TTGGACACACAACAGCAGTGGGG - Intergenic
925024535 2:597292-597314 CTGGGGACACACCACCATCAAGG + Intergenic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
940656608 2:156494712-156494734 TGGGAAAAACACCACCATCATGG + Intronic
940830836 2:158463567-158463589 TGGGACACACACCTGCATAGTGG - Intronic
941619164 2:167757314-167757336 CTGGACACCCACCATCATGGGGG - Intergenic
948200277 2:236124619-236124641 TTTGACACACACCATCATAGGGG - Exonic
948388784 2:237597770-237597792 TTGGACACAGGCCTCCATCCAGG + Intronic
948606696 2:239140472-239140494 TTGGGCACACACATCCACCGTGG + Intronic
1170600696 20:17839166-17839188 TCAGACACACACCATCTTCGTGG - Intergenic
1176686510 21:9852662-9852684 TGAGACACCCACCACCATCCAGG - Intergenic
1181980631 22:26763497-26763519 TTGGACACAGATCACCATAGAGG - Intergenic
1182858027 22:33535223-33535245 TTGGACCCACAGCATCAGCGTGG - Intronic
1185373177 22:50470165-50470187 TTGGCCCCAAACCACCATCTGGG + Intronic
953371947 3:42396281-42396303 TGGGACCCACACCATCATGGGGG - Intergenic
962361708 3:134748655-134748677 CTGGACACACACCAGCATACAGG - Intronic
974990763 4:69085753-69085775 TTGGACACATACCACCAACCAGG - Intronic
980349958 4:131671131-131671153 TGAGACACCCACCACCATCCAGG - Intergenic
989719165 5:44504253-44504275 TTGGCCACACAGCAGCATCCAGG - Intergenic
998980806 5:147699948-147699970 TAGGTCACACACCACCATGAAGG - Intronic
1002261161 5:177994971-177994993 CTGGACACACACGACCACCTGGG + Intronic
1002437777 5:179242712-179242734 TTGGCCACACACCCCCAGAGTGG - Intronic
1004454603 6:15780276-15780298 TTGGAAAGACACCATCATCCTGG - Intergenic
1005706075 6:28454838-28454860 TTGGAGACACAGCACCATTTAGG + Intergenic
1007071131 6:39039067-39039089 CAGGACACACATCACCATGGAGG + Intergenic
1010917455 6:81637861-81637883 TTGCACTTACACCACCATCTTGG + Intronic
1018995908 6:168710240-168710262 TGGGACACACAGCACCTGCGTGG - Intergenic
1019307316 7:341985-342007 CTGGACACACAGCCACATCGAGG - Intergenic
1022439880 7:30424624-30424646 TTGGACACCCCCCACCATGGTGG - Exonic
1024532538 7:50405753-50405775 CTGGACACAGCCCACCCTCGAGG + Intergenic
1024588201 7:50859095-50859117 TTGGACACCTTCCACCATGGAGG + Intergenic
1043326996 8:79064597-79064619 TTGGCCACAAACCACAATCAAGG + Intergenic
1047679590 8:127240808-127240830 TTTGACACCCACCATCATCCAGG + Intergenic
1053782810 9:41628930-41628952 TGAGACACCCACCACCATCCAGG + Intergenic
1054170761 9:61839070-61839092 TGAGACACCCACCACCATCCAGG + Intergenic
1054666775 9:67741737-67741759 TGAGACACCCACCACCATCCAGG - Intergenic
1056805396 9:89724926-89724948 TTGGACACACACCAGCACAGAGG + Intergenic
1059940078 9:119350160-119350182 GGGGACACACACCAGCATCTGGG + Intronic
1060332536 9:122686146-122686168 TGAAACACACACCACCATCCAGG + Intergenic
1062143130 9:134971284-134971306 TTGGACTCTCACCCCCATTGTGG - Intergenic
1062670772 9:137707610-137707632 TTGGACACACAGCAGAATGGTGG + Intronic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619203 X:1443017-1443039 TTGGAGAGACACCACCATCTTGG + Intronic
1185619206 X:1443036-1443058 TTGGACGCATACCACCATCGTGG + Intronic
1185619209 X:1443055-1443077 GTGGACACACACCGTCGTCGTGG + Intronic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619214 X:1443093-1443115 TGGGACACACACCGTCGTCGTGG + Intronic
1185619216 X:1443112-1443134 GTGGACACACACCGCCGTCGTGG + Intronic
1185619219 X:1443131-1443153 GTGGACACACGCCGCCATCTTGG + Intronic
1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG + Intronic
1185619225 X:1443169-1443191 GTGGACACACACCGCCATCGTGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619232 X:1443226-1443248 GTGCACACACACCGCCGTCGTGG + Intronic
1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619256 X:1443378-1443400 ATGGACACACGCCGCCATCTTGG + Intronic
1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic
1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG + Intronic
1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619289 X:1443594-1443616 TTGGACAGACACCGCCATCGTGG + Intronic
1185619292 X:1443613-1443635 GTGGACAGACACCGCCATCGTGG + Intronic
1185619295 X:1443632-1443654 GTGGACAGACACCGCCATCATGG + Intronic
1185619298 X:1443651-1443673 ATGGACACACACCGCCATCATGG + Intronic
1185619301 X:1443670-1443692 ATGGACACACACCGCCATCGTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619308 X:1443717-1443739 GTGGACACACACCCCCATCGTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619318 X:1443780-1443802 GTGGACACACACCCCCATCGTGG + Intronic
1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG + Intronic
1185619330 X:1443843-1443865 GAGGACACACACCACCATCGTGG + Intronic
1185619333 X:1443862-1443884 GTGGACAGACACCGCCGTCGTGG + Intronic
1185619336 X:1443881-1443903 GTGGACAGACACCCCCATCATGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619344 X:1443919-1443941 TTGGACAGACACCCCCGTCTTGG + Intronic
1185619870 X:1447270-1447292 TTCGACACACACTGCCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619879 X:1447327-1447349 TTGGATAAGCACCACCATCTTGG + Intronic
1185619884 X:1447362-1447384 TTGGACACACATGGCCATCTTGG + Intronic
1185619886 X:1447381-1447403 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619891 X:1447419-1447441 TTGGATAAGCACCACCATCTTGG + Intronic
1185619897 X:1447454-1447476 TTGGACACACACGGCCATGTTGG + Intronic
1185619899 X:1447473-1447495 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619912 X:1447546-1447568 TTGGACACACACGGCCATCTTGG + Intronic
1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619922 X:1447619-1447641 TTGGATAAGCACCACCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619930 X:1447673-1447695 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619939 X:1447746-1447768 TTTGACACACACCACCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619945 X:1447784-1447806 TTGGATAAGCACCACCATCTTGG + Intronic
1185619948 X:1447803-1447825 TTGGACACACACAGCTATCTTGG + Intronic
1185619954 X:1447857-1447879 TGGGACACACACTGCCATCTTGG + Intronic
1185619956 X:1447876-1447898 TTGGACCCATAACACCATCTTGG + Intronic
1185619960 X:1447895-1447917 TTGGACAAGCACCGCCATCTTGG + Intronic
1185619966 X:1447931-1447953 TTGGATACACAACACCATCTTGG + Intronic
1185619968 X:1447950-1447972 TTGGAAAAGCACCACCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185619989 X:1448096-1448118 TTGGATAAGCACCACCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185619997 X:1448150-1448172 TTGGATAAGCACCACCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620003 X:1448188-1448210 TTGGATAAGCACCACCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620010 X:1448242-1448264 TTGGATAAGCACCACCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620017 X:1448296-1448318 TTGGATAAGCACCACCATCTTGG + Intronic
1185620023 X:1448331-1448353 TGGGACACACACTGCCATCTTGG + Intronic
1185620025 X:1448350-1448372 TTGGACCCATAACACCATCTTGG + Intronic
1185620029 X:1448369-1448391 TTGGACAAGCACCACCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185620041 X:1448441-1448463 TTGGAAAAGCACCACCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620047 X:1448495-1448517 TTGGATAAGCACCACCATCTTGG + Intronic
1185620050 X:1448514-1448536 TTGGACACATGCCGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620055 X:1448552-1448574 TTGGATAAGCACCACCATCTTGG + Intronic
1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG + Intronic
1185620063 X:1448606-1448628 TTGGATAAGCACCACCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620069 X:1448644-1448666 TTGGATAAGCACCACCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1185620076 X:1448698-1448720 TTGGAGAAGCACCACCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1185620085 X:1448752-1448774 TTGGATAAGCACCACCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG + Intronic
1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1186913665 X:14196907-14196929 TTGCACAGACACCACTATGGAGG - Intergenic
1190250140 X:48717137-48717159 TGGGACACACACCACCAAATAGG + Intergenic
1197166100 X:123379319-123379341 TTGGACACACAAAACCCTCATGG - Intronic
1198211349 X:134519247-134519269 TTGGACACAGACACCCATAGAGG - Intronic