ID: 1185619273

View in Genome Browser
Species Human (GRCh38)
Location X:1443484-1443506
Sequence GTCCATGATGGCCAAGATGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619273_1185619277 11 Left 1185619273 X:1443484-1443506 CCGCCATCTTGGCCATCATGGAC No data
Right 1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG No data
1185619273_1185619276 -8 Left 1185619273 X:1443484-1443506 CCGCCATCTTGGCCATCATGGAC No data
Right 1185619276 X:1443499-1443521 TCATGGACACAGTGTCATTGTGG No data
1185619273_1185619280 30 Left 1185619273 X:1443484-1443506 CCGCCATCTTGGCCATCATGGAC No data
Right 1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619273 Original CRISPR GTCCATGATGGCCAAGATGG CGG (reversed) Intronic