ID: 1185619274 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:1443487-1443509 |
| Sequence | TGTGTCCATGATGGCCAAGA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1185619274_1185619277 | 8 | Left | 1185619274 | X:1443487-1443509 | CCATCTTGGCCATCATGGACACA | No data | ||
| Right | 1185619277 | X:1443518-1443540 | GTGGACACACACCGCCATCTTGG | No data | ||||
| 1185619274_1185619280 | 27 | Left | 1185619274 | X:1443487-1443509 | CCATCTTGGCCATCATGGACACA | No data | ||
| Right | 1185619280 | X:1443537-1443559 | TTGGACAGACACCTCCATCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1185619274 | Original CRISPR | TGTGTCCATGATGGCCAAGA TGG (reversed) | Intronic | ||