ID: 1185619275

View in Genome Browser
Species Human (GRCh38)
Location X:1443496-1443518
Sequence CAATGACACTGTGTCCATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619275_1185619280 18 Left 1185619275 X:1443496-1443518 CCATCATGGACACAGTGTCATTG No data
Right 1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG No data
1185619275_1185619277 -1 Left 1185619275 X:1443496-1443518 CCATCATGGACACAGTGTCATTG No data
Right 1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619275 Original CRISPR CAATGACACTGTGTCCATGA TGG (reversed) Intronic