ID: 1185619277

View in Genome Browser
Species Human (GRCh38)
Location X:1443518-1443540
Sequence GTGGACACACACCGCCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619275_1185619277 -1 Left 1185619275 X:1443496-1443518 CCATCATGGACACAGTGTCATTG No data
Right 1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG No data
1185619270_1185619277 27 Left 1185619270 X:1443468-1443490 CCATCGTGGACACATGCCGCCAT No data
Right 1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG No data
1185619269_1185619277 30 Left 1185619269 X:1443465-1443487 CCACCATCGTGGACACATGCCGC No data
Right 1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG No data
1185619273_1185619277 11 Left 1185619273 X:1443484-1443506 CCGCCATCTTGGCCATCATGGAC No data
Right 1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG No data
1185619274_1185619277 8 Left 1185619274 X:1443487-1443509 CCATCTTGGCCATCATGGACACA No data
Right 1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619277 Original CRISPR GTGGACACACACCGCCATCT TGG Intronic