ID: 1185619277

View in Genome Browser
Species Human (GRCh38)
Location X:1443518-1443540
Sequence GTGGACACACACCGCCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 27, 2: 25, 3: 34, 4: 77}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619269_1185619277 30 Left 1185619269 X:1443465-1443487 CCACCATCGTGGACACATGCCGC 0: 1
1: 1
2: 6
3: 25
4: 55
Right 1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG 0: 1
1: 27
2: 25
3: 34
4: 77
1185619270_1185619277 27 Left 1185619270 X:1443468-1443490 CCATCGTGGACACATGCCGCCAT 0: 1
1: 2
2: 5
3: 33
4: 100
Right 1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG 0: 1
1: 27
2: 25
3: 34
4: 77
1185619274_1185619277 8 Left 1185619274 X:1443487-1443509 CCATCTTGGCCATCATGGACACA 0: 1
1: 2
2: 1
3: 48
4: 2066
Right 1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG 0: 1
1: 27
2: 25
3: 34
4: 77
1185619273_1185619277 11 Left 1185619273 X:1443484-1443506 CCGCCATCTTGGCCATCATGGAC 0: 1
1: 0
2: 1
3: 29
4: 438
Right 1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG 0: 1
1: 27
2: 25
3: 34
4: 77
1185619275_1185619277 -1 Left 1185619275 X:1443496-1443518 CCATCATGGACACAGTGTCATTG 0: 1
1: 0
2: 0
3: 17
4: 172
Right 1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG 0: 1
1: 27
2: 25
3: 34
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619277 Original CRISPR GTGGACACACACCGCCATCT TGG Intronic
901881221 1:12194864-12194886 GTGGACCCACAGCGCAACCTTGG + Intronic
906054072 1:42900549-42900571 CTGAACACACACCGCCACCAGGG - Intergenic
906214873 1:44032860-44032882 GTGCACACACACCTGGATCTAGG + Intergenic
907056343 1:51372241-51372263 CTTGACACACACCGCCCACTAGG - Intronic
916801571 1:168221177-168221199 GTGAACACACAAAGCAATCTAGG + Intergenic
917855375 1:179095124-179095146 GGGGACATACACCATCATCTGGG - Exonic
921196234 1:212760383-212760405 GTGCACACACTCAGCCATCAAGG + Intronic
1063685486 10:8233442-8233464 CTGGGCACACATAGCCATCTAGG + Intergenic
1076115089 10:127889898-127889920 GTGGACACCCACCTCCTTCTCGG - Intronic
1076606843 10:131694865-131694887 GTGGCCACACAGCTCCTTCTGGG - Intergenic
1076696953 10:132251585-132251607 GTGGGCACCCACCACCCTCTTGG - Intronic
1076868732 10:133182357-133182379 GTGGACACGCACCTGCATCCTGG - Intronic
1081990670 11:47335865-47335887 GGGGACACTCACAGCCCTCTGGG + Exonic
1086701818 11:89907106-89907128 GTGGACACACCCTGCGATATGGG + Intergenic
1086704350 11:89937419-89937441 GTGGACACACCCTGCGATATGGG - Intergenic
1091481647 12:838554-838576 ATGGACACACACCACCATGCTGG + Intronic
1091836577 12:3590392-3590414 GTGTTCACACAGCGCCAACTGGG - Intronic
1097432883 12:59530353-59530375 GCGGACACACACTGCGATTTGGG - Intergenic
1098379250 12:69851798-69851820 ACAGACACACACCACCATCTTGG + Intronic
1100717571 12:97322087-97322109 TAGGACACACACAGCCCTCTTGG - Intergenic
1102692250 12:114770519-114770541 GTGCATACCCACTGCCATCTGGG + Intergenic
1103504212 12:121430330-121430352 CTGGACACTCACAGACATCTCGG + Exonic
1106251712 13:27986974-27986996 GTGGACACTCACCCACTTCTGGG - Intronic
1111810311 13:93090525-93090547 GTGGACACCCCCCGCGATATGGG + Intergenic
1113843468 13:113373150-113373172 GTGGACATACACTGCCTCCTAGG + Intergenic
1114823495 14:26050137-26050159 GTGGACACAAAACCTCATCTGGG - Intergenic
1118214219 14:63793201-63793223 GTTGACACACACAGCCACCTTGG + Intergenic
1120132416 14:80823064-80823086 GTTGACACACATGGCCACCTTGG + Intronic
1121715570 14:96071571-96071593 GTGAACACACACTGCCCCCTGGG + Intronic
1124553996 15:30708918-30708940 GTGGGCACCCACCCCCATCTGGG + Intronic
1124677251 15:31696753-31696775 GTGGGCACCCACCCCCATCTGGG - Intronic
1129702140 15:77774173-77774195 GTGCACACTCACCACCCTCTAGG - Intronic
1138128750 16:54460515-54460537 GTGGACAGACAGAGCCAGCTAGG + Intergenic
1141067818 16:80928127-80928149 GTGGATTCACACCGGCATGTGGG + Intergenic
1142314713 16:89336351-89336373 GTGGACGCACACCCGCCTCTAGG - Intronic
1145007543 17:19346080-19346102 GGGGACCCACACAGCCATCCAGG - Intronic
1148107461 17:45127060-45127082 GTGGCCACACACAGCCCTTTGGG - Intronic
1149948715 17:60960819-60960841 CTGCAGAAACACCGCCATCTTGG - Intronic
1152878093 17:82799771-82799793 GTGAACACAGACCTCCCTCTTGG + Intronic
1155542592 18:26884051-26884073 GTGGACACCCCCCGCCATATGGG - Intergenic
1155542615 18:26884129-26884151 CTGGACACCCTCCGCCATATGGG - Intergenic
1156009186 18:32476265-32476287 GTTGACACACATAGCCACCTTGG - Intergenic
1158106131 18:53887083-53887105 GTGGACTCACACACCCATATGGG - Intergenic
1158259326 18:55589913-55589935 GTCGACCAGCACCGCCATCTTGG - Intronic
1159946622 18:74448612-74448634 GTGCACACACACTTCCCTCTTGG - Intronic
1160016436 18:75144390-75144412 ATGAACACACACCCCCATGTAGG - Intergenic
1161698361 19:5782621-5782643 TTGGAGACACACAGCCATCAGGG - Intergenic
1166237034 19:41464211-41464233 GTGTACACACCCCGCGATATAGG + Intergenic
1166244676 19:41517024-41517046 GTGTACACACCCCGCGATATGGG + Intergenic
1166244826 19:41517928-41517950 GTGGACACACCCTGCGATATTGG + Intergenic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
930936836 2:56963462-56963484 GTGGACAAACACCGGAAGCTAGG - Intergenic
935320002 2:101877439-101877461 GTGGACACAGACCTACATATTGG - Intronic
939003699 2:136763623-136763645 CTGCACACACACCCCCATATGGG - Intergenic
946948092 2:224843105-224843127 GTGGACACTCCCCGCAATATGGG - Intronic
947434239 2:230059182-230059204 GAGGACACCCAGGGCCATCTGGG + Exonic
948316717 2:237032799-237032821 GTCTACACACACCACCATGTGGG + Intergenic
1168970993 20:1930533-1930555 GTGGCTACACAGCCCCATCTAGG + Intronic
1175908638 20:62394116-62394138 GTGGACACCCAGCGCCGTCAGGG - Intronic
1179009568 21:37545909-37545931 GTGGACCTACATCGCCATCCTGG - Intergenic
953387733 3:42516198-42516220 GTGGGCACACACAGCCAGCCTGG + Intronic
978292004 4:107152731-107152753 GTGTACACACACAGCCAAATAGG + Intronic
987195703 5:15523804-15523826 GTGGACACGCAACTCCATCTGGG - Intronic
994391478 5:99197429-99197451 GTGGACACCCTCTGCCATATTGG + Intergenic
1002261161 5:177994971-177994993 CTGGACACACACGACCACCTGGG + Intronic
1002706325 5:181162801-181162823 GTGGACACACAGGGCCATCACGG + Intergenic
1007200344 6:40102770-40102792 GTGAACACACAGGGCCTTCTAGG + Intergenic
1007407469 6:41643291-41643313 CTTGACACACTCAGCCATCTGGG + Intronic
1007697736 6:43744396-43744418 GTGCACACACACAGCCAACTGGG - Intergenic
1009364110 6:62844840-62844862 GTGGACACCCCCCGCGATATTGG - Intergenic
1009366367 6:62860814-62860836 GTGGACACTCCCCGCCATATGGG - Intergenic
1009366415 6:62860974-62860996 GTGGACACCCCCCGCCATATGGG - Intergenic
1009366438 6:62861055-62861077 GTGGACACCCCCCGCCATATGGG - Intergenic
1009366518 6:62861360-62861382 GTGGACACCCCCAGCCATATGGG - Intergenic
1020335591 7:7059918-7059940 GTGGACACACCTCGCCATATAGG + Intergenic
1035370260 7:158375431-158375453 GTGGCCAAACCCAGCCATCTCGG + Intronic
1045337497 8:101221753-101221775 GTACACACACACACCCATCTTGG - Intergenic
1045926348 8:107581780-107581802 GAGGACACACTCCGCCACATCGG + Intergenic
1058519090 9:105801739-105801761 GTGTACACACACTGCGATATTGG + Intergenic
1059940078 9:119350160-119350182 GGGGACACACACCAGCATCTGGG + Intronic
1062267046 9:135691690-135691712 GTGGACACACACCAACACATGGG + Intergenic
1062290802 9:135793537-135793559 GTGCACACACATCCCCACCTGGG - Intergenic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619203 X:1443017-1443039 TTGGAGAGACACCACCATCTTGG + Intronic
1185619209 X:1443055-1443077 GTGGACACACACCGTCGTCGTGG + Intronic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619216 X:1443112-1443134 GTGGACACACACCGCCGTCGTGG + Intronic
1185619219 X:1443131-1443153 GTGGACACACGCCGCCATCTTGG + Intronic
1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG + Intronic
1185619225 X:1443169-1443191 GTGGACACACACCGCCATCGTGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619232 X:1443226-1443248 GTGCACACACACCGCCGTCGTGG + Intronic
1185619235 X:1443245-1443267 GTGGACACACGCCGCCGTCTTGG + Intronic
1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619256 X:1443378-1443400 ATGGACACACGCCGCCATCTTGG + Intronic
1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic
1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG + Intronic
1185619271 X:1443473-1443495 GTGGACACATGCCGCCATCTTGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG + Intronic
1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619289 X:1443594-1443616 TTGGACAGACACCGCCATCGTGG + Intronic
1185619292 X:1443613-1443635 GTGGACAGACACCGCCATCGTGG + Intronic
1185619295 X:1443632-1443654 GTGGACAGACACCGCCATCATGG + Intronic
1185619298 X:1443651-1443673 ATGGACACACACCGCCATCATGG + Intronic
1185619301 X:1443670-1443692 ATGGACACACACCGCCATCGTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619308 X:1443717-1443739 GTGGACACACACCCCCATCGTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619318 X:1443780-1443802 GTGGACACACACCCCCATCGTGG + Intronic
1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG + Intronic
1185619330 X:1443843-1443865 GAGGACACACACCACCATCGTGG + Intronic
1185619333 X:1443862-1443884 GTGGACAGACACCGCCGTCGTGG + Intronic
1185619336 X:1443881-1443903 GTGGACAGACACCCCCATCATGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619344 X:1443919-1443941 TTGGACAGACACCCCCGTCTTGG + Intronic
1185619349 X:1443938-1443960 TTGGACAGACACTGCCATGTTGG + Intronic
1185619870 X:1447270-1447292 TTCGACACACACTGCCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619884 X:1447362-1447384 TTGGACACACATGGCCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619897 X:1447454-1447476 TTGGACACACACGGCCATGTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619912 X:1447546-1447568 TTGGACACACACGGCCATCTTGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619935 X:1447708-1447730 TTGGACAAGCACTGCCATCTTGG + Intronic
1185619939 X:1447746-1447768 TTTGACACACACCACCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619948 X:1447803-1447825 TTGGACACACACAGCTATCTTGG + Intronic
1185619954 X:1447857-1447879 TGGGACACACACTGCCATCTTGG + Intronic
1185619960 X:1447895-1447917 TTGGACAAGCACCGCCATCTTGG + Intronic
1185619966 X:1447931-1447953 TTGGATACACAACACCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620023 X:1448331-1448353 TGGGACACACACTGCCATCTTGG + Intronic
1185620029 X:1448369-1448391 TTGGACAAGCACCACCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620050 X:1448514-1448536 TTGGACACATGCCGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620094 X:1448809-1448831 TTGGACAAGCACTGCCATCTTGG + Intronic
1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1190217788 X:48491670-48491692 GTGTACAGACACCACAATCTAGG - Intergenic
1191692222 X:63952387-63952409 CTGAACACACACCCCCAACTGGG + Intergenic