ID: 1185619280

View in Genome Browser
Species Human (GRCh38)
Location X:1443537-1443559
Sequence TTGGACAGACACCTCCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 2, 2: 21, 3: 37, 4: 174}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619275_1185619280 18 Left 1185619275 X:1443496-1443518 CCATCATGGACACAGTGTCATTG 0: 1
1: 0
2: 0
3: 17
4: 172
Right 1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG 0: 1
1: 2
2: 21
3: 37
4: 174
1185619274_1185619280 27 Left 1185619274 X:1443487-1443509 CCATCTTGGCCATCATGGACACA 0: 1
1: 2
2: 1
3: 48
4: 2066
Right 1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG 0: 1
1: 2
2: 21
3: 37
4: 174
1185619273_1185619280 30 Left 1185619273 X:1443484-1443506 CCGCCATCTTGGCCATCATGGAC 0: 1
1: 0
2: 1
3: 29
4: 438
Right 1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG 0: 1
1: 2
2: 21
3: 37
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619280 Original CRISPR TTGGACAGACACCTCCATCT TGG Intronic
901646970 1:10722076-10722098 CTGGGCAGACACCTGCGTCTTGG + Intronic
905992378 1:42349457-42349479 TTTGAGAGACACCTGCATTTAGG - Intergenic
912265651 1:108154557-108154579 TTGGAGTGACACCTCCATGAAGG - Intronic
912564196 1:110573898-110573920 TTGGACTGACAGCTCTAGCTAGG - Intergenic
912711759 1:111954951-111954973 TAAGACAGACAGCTCCATCTAGG - Intronic
913088177 1:115458197-115458219 ATGAACAGAACCCTCCATCTGGG + Intergenic
914420509 1:147524367-147524389 TTGCTCAGCCACCTCCCTCTAGG + Intergenic
915598295 1:156907670-156907692 TTTGGAAGACACCTCCATTTTGG - Exonic
917766183 1:178219901-178219923 TTAGTCAGACACCTCCCACTAGG - Intronic
918512957 1:185331293-185331315 GTGGACAGACACCTGCAGCGAGG + Intergenic
919800925 1:201354211-201354233 TTGGCCAGCCTCCTCCTTCTTGG - Intergenic
920790063 1:209081615-209081637 TTGGACAGATTACTCCATCAGGG - Intergenic
922289661 1:224199763-224199785 TTGAACAGACAGCACCGTCTGGG + Intergenic
922363979 1:224846604-224846626 TTGGACATACCTCTCCCTCTTGG + Intergenic
922963365 1:229666863-229666885 TTGGACAGACACCTGCAGCAGGG + Intergenic
923032342 1:230259458-230259480 TTGGTAAGTCAGCTCCATCTGGG - Intronic
1064357703 10:14634788-14634810 TTGGATAGAAACCTCAGTCTTGG + Intronic
1065015928 10:21462813-21462835 TTTGACAGGCACTTCCATGTGGG - Intergenic
1066209475 10:33223106-33223128 TGGGTCAGACACCTCCTTTTAGG + Intronic
1071554722 10:86593244-86593266 CTGGATAGAGACCTCCAGCTAGG + Intergenic
1072794995 10:98347790-98347812 ATGGACCGACACCTAAATCTTGG + Intergenic
1075784253 10:125038158-125038180 TAGGACAGACAATTCCATATGGG + Intronic
1076115089 10:127889898-127889920 GTGGACACCCACCTCCTTCTCGG - Intronic
1078450552 11:11437646-11437668 ATAGCCAGACACCTCCGTCTTGG + Intronic
1081085299 11:38792108-38792130 AGGGACAGACAACACCATCTAGG + Intergenic
1082214688 11:49554664-49554686 TTGGACAGAGGACTTCATCTTGG + Intergenic
1082781909 11:57294576-57294598 TTGGTCAGACACCTGCCTTTAGG + Intergenic
1086634899 11:89069800-89069822 TTGGACAGAGGACTTCATCTTGG - Intergenic
1089625518 11:119748539-119748561 GTGGAAAGACCCCTCCAGCTGGG - Intergenic
1090485530 11:127108937-127108959 CAGGACAGGCACCTCCGTCTAGG - Intergenic
1092033612 12:5311078-5311100 TTGGGCAATCACCTCCACCTAGG + Intergenic
1093930299 12:24949185-24949207 TGGGAGAGACTCCACCATCTGGG - Intronic
1094212222 12:27904662-27904684 AAGGACAGACACCCCCAACTTGG + Intergenic
1095048392 12:37534789-37534811 TTCCACTGACACCTCCCTCTTGG + Intergenic
1098585460 12:72148916-72148938 ATGAACAGACAGCTCCATATAGG + Intronic
1098979110 12:76935937-76935959 TTGGCCAGACAAGACCATCTAGG - Intergenic
1099426428 12:82529306-82529328 TTAGCCAGGCAGCTCCATCTTGG - Intergenic
1099520228 12:83650825-83650847 TTGGAAAGCCACCTCAACCTTGG + Intergenic
1104890898 12:132139635-132139657 CTTGACAGACTCCTCCAGCTGGG + Exonic
1111584986 13:90272187-90272209 TTGGACAGAAATCATCATCTGGG - Intergenic
1113345997 13:109479201-109479223 TAAGCCAGACACCCCCATCTTGG + Intergenic
1114151449 14:20044460-20044482 CTGTACAGACACTTACATCTTGG + Intergenic
1114948233 14:27714459-27714481 TTAGACAGACACCTCCTTATTGG - Intergenic
1118402545 14:65393237-65393259 TTATAAAGCCACCTCCATCTAGG - Intergenic
1121627525 14:95397258-95397280 TTGCACAGACGCCTCCCTCATGG + Intergenic
1123720376 15:23055785-23055807 ATGGAGAGACTCCTTCATCTTGG - Intergenic
1127958581 15:63873882-63873904 TGGTACAGACACCCCCAACTAGG + Intergenic
1132306630 15:100819594-100819616 TTGGCAAGCCACCTCCAGCTGGG - Intergenic
1134634829 16:15784347-15784369 TGGGACAGACATCTCTGTCTAGG + Intronic
1134857055 16:17528833-17528855 GAGGACAGAAATCTCCATCTAGG + Intergenic
1141789460 16:86224508-86224530 TGTGACAGACACCCCCATTTTGG - Intergenic
1143196561 17:5080268-5080290 ATGGACATCCACCTTCATCTGGG - Intronic
1143341702 17:6216221-6216243 TGGGACTGGCACCTCCCTCTTGG + Intergenic
1144495240 17:15741601-15741623 ATGGGCAGACACTTCCATCTTGG - Intronic
1144921478 17:18767870-18767892 TGGGACAGACACTACCTTCTTGG - Intronic
1148496822 17:48058040-48058062 TTGGCCAGACTCCCCCATCTTGG - Intronic
1152621477 17:81367062-81367084 TTGGACTGTCACCTCCTTCCGGG - Intergenic
1157492408 18:48133321-48133343 TTGGAAGGCCCCCTCCATCTAGG - Intronic
1161896014 19:7080978-7081000 TTAGACAGACAGCTCCATGAGGG - Intronic
1162525519 19:11204044-11204066 GTGGACAGCCACCTGCCTCTGGG - Intronic
1165712830 19:38024352-38024374 TTTGACAGACACTTCCTTGTAGG + Intronic
1166121066 19:40687075-40687097 TCGGCCAGCCCCCTCCATCTTGG + Intronic
1167807839 19:51800966-51800988 CTGGACAGTCACCTCTCTCTGGG - Intronic
1168057050 19:53869701-53869723 TTGGACAGGCTCCTCCCTCTAGG - Intronic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
938405866 2:131032768-131032790 TTGGACAGACAGCTCCCACCAGG - Intronic
939574003 2:143874303-143874325 TGACACAGACACCTCCAACTAGG + Intergenic
940610196 2:155980393-155980415 TGGGAGACACACATCCATCTTGG + Intergenic
944663292 2:201938918-201938940 TGGAACAGAGACCGCCATCTCGG + Intergenic
947523897 2:230866936-230866958 TCTGACAGAGACCTGCATCTCGG + Intronic
948388784 2:237597770-237597792 TTGGACACAGGCCTCCATCCAGG + Intronic
948544792 2:238719810-238719832 ATGGACAGACACATCCACATGGG + Intergenic
1170055552 20:12199006-12199028 TTGGGCAGAAACCTTCATCCTGG + Intergenic
1173249431 20:41356865-41356887 ATGCACAGACACATCCATGTGGG - Intronic
1174046807 20:47739531-47739553 TTGATCAGACACCACCTTCTTGG + Intronic
1175669655 20:60890949-60890971 GGGGACAGACACCTCCTTCAGGG + Intergenic
1177779470 21:25607345-25607367 CTAGACAGACACCACTATCTAGG + Intronic
1178476422 21:32941218-32941240 TTGCGCAGACACCTTGATCTTGG - Intergenic
1178632327 21:34273413-34273435 TTGGACATACACTTCCCTTTGGG + Intergenic
1178994593 21:37387076-37387098 TTGCACACCCACCTCCATTTAGG - Intronic
1179125160 21:38583850-38583872 TTGGGCTGACACCTTGATCTTGG + Intronic
1180609733 22:17087383-17087405 TTGGACAGACACTTACATTCTGG - Intronic
1181788170 22:25242684-25242706 TTGGACAGAAACTGCTATCTCGG - Intergenic
1182452436 22:30429432-30429454 TGGGGCTGACACCACCATCTTGG - Intergenic
951662340 3:25082930-25082952 TTGGATATACAGCTCCAGCTTGG + Intergenic
953504828 3:43475236-43475258 TTGGACATATAGCTCCTTCTCGG + Intronic
954678009 3:52326251-52326273 CTGGAAAGGCACCTGCATCTTGG - Exonic
954698259 3:52438923-52438945 TTTGACAGAGATCTCCATTTCGG + Exonic
954850936 3:53599859-53599881 TAGGACAGACACCTCAACCCTGG - Intronic
958000835 3:87746848-87746870 CTGGTCAGACATTTCCATCTAGG - Intergenic
961495285 3:127287148-127287170 TGGGACCACCACCTCCATCTGGG - Intergenic
964200116 3:154109327-154109349 CTGGAAAGCCAGCTCCATCTGGG - Intergenic
970652773 4:18196909-18196931 CTGGAGAGACAGCTCCAGCTGGG + Intergenic
971008543 4:22404050-22404072 TTGGAAAGACACCTCTACCCTGG + Intronic
973886805 4:55330590-55330612 TTGGAGAGTCACCTCCTTGTGGG - Intergenic
974286777 4:59879108-59879130 CTGGAGAGACAGCTCCAGCTGGG - Intergenic
977953774 4:103003524-103003546 TTGTAGAAACACCTCAATCTAGG + Intronic
980753517 4:137125128-137125150 TTGGACAAACCCCTCCCCCTAGG + Intergenic
983021437 4:162680911-162680933 TTTGCTTGACACCTCCATCTTGG - Intergenic
983289730 4:165786637-165786659 TTGTACTGACACCTTCATCCTGG - Intergenic
985829326 5:2216535-2216557 TTGGAGAGCCTCCTCCATCCAGG + Intergenic
986462554 5:7987252-7987274 TTCAGCTGACACCTCCATCTTGG + Intergenic
986564684 5:9100344-9100366 TTTGCCAGACACATCCACCTGGG + Intronic
987026408 5:13930999-13931021 TAAGACAGGCACCTCCCTCTGGG + Intronic
987195703 5:15523804-15523826 GTGGACACGCAACTCCATCTGGG - Intronic
989693327 5:44170909-44170931 TTGGCTAGAACCCTCCATCTTGG + Intergenic
992881008 5:81109868-81109890 TAGGACAGAAACCTGTATCTTGG + Intronic
1000229818 5:159305232-159305254 TTGGACAGCCATCCCCAGCTTGG + Intergenic
1001341868 5:170854574-170854596 TTGGCCTGACACCTCCAGCAAGG - Intergenic
1003286978 6:4742933-4742955 TTGGACAGAAACCTCAAGCTTGG - Intronic
1003362341 6:5439999-5440021 TTGAACAGACATCTCCATTCTGG - Intronic
1004454603 6:15780276-15780298 TTGGAAAGACACCATCATCCTGG - Intergenic
1006473399 6:34240585-34240607 GTGGGCAGACCCCTCCATCCTGG + Intronic
1009972443 6:70639163-70639185 TTTGACAAACAGCTTCATCTCGG - Intergenic
1010917455 6:81637861-81637883 TTGCACTTACACCACCATCTTGG + Intronic
1011125618 6:84003991-84004013 TGGTACAGACTCCTCCAGCTGGG + Intergenic
1014819590 6:125972535-125972557 TTGGACAGACAAGTCTATATGGG + Intronic
1017881385 6:158565018-158565040 TGTGAGAGACACCTTCATCTCGG - Intronic
1019149080 6:169992634-169992656 TGGGACAGGCACCTCAGTCTGGG - Intergenic
1021251891 7:18338868-18338890 TTCAACAGTCAACTCCATCTGGG + Intronic
1023730592 7:43188184-43188206 TTGTACAGGCATCTCCAACTTGG - Intronic
1025534872 7:61935153-61935175 TTTCACAGATACCTCCTTCTTGG - Intergenic
1033937802 7:146609633-146609655 TTGGACAAACACCTCTACCATGG - Intronic
1035218512 7:157390121-157390143 TGGGACAGCAACCACCATCTGGG - Intronic
1038383797 8:27121707-27121729 TTGGACTGATGCCTCCCTCTTGG - Intergenic
1040887689 8:52283262-52283284 TCTGACAGTCACCTCCATCATGG - Intronic
1041087716 8:54272015-54272037 ATGGACAACAACCTCCATCTCGG + Intergenic
1042065406 8:64869536-64869558 TTGGACACATAACTCCACCTGGG + Intergenic
1044585788 8:93868324-93868346 TTGGACAGCCAACACCATTTTGG - Intronic
1045230559 8:100302499-100302521 TTGGATATACATCTCCACCTAGG - Intronic
1048301993 8:133258585-133258607 CTGGACAGAGACCTCGACCTTGG + Intronic
1050603115 9:7272494-7272516 TTGGCGAGGCACATCCATCTAGG + Intergenic
1057070423 9:92094149-92094171 TTGGTCAGATGCATCCATCTTGG - Intronic
1061398562 9:130356234-130356256 ATGCACAGACACCTCCACCTCGG - Intronic
1061782042 9:133001908-133001930 TTGGTCAGACACTGCCCTCTGGG + Intergenic
1062321455 9:135992452-135992474 TAGGGCAGCCACCTCCCTCTGGG + Intergenic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619203 X:1443017-1443039 TTGGAGAGACACCACCATCTTGG + Intronic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619219 X:1443131-1443153 GTGGACACACGCCGCCATCTTGG + Intronic
1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG + Intronic
1185619225 X:1443169-1443191 GTGGACACACACCGCCATCGTGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619256 X:1443378-1443400 ATGGACACACGCCGCCATCTTGG + Intronic
1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic
1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG + Intronic
1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619289 X:1443594-1443616 TTGGACAGACACCGCCATCGTGG + Intronic
1185619292 X:1443613-1443635 GTGGACAGACACCGCCATCGTGG + Intronic
1185619295 X:1443632-1443654 GTGGACAGACACCGCCATCATGG + Intronic
1185619298 X:1443651-1443673 ATGGACACACACCGCCATCATGG + Intronic
1185619301 X:1443670-1443692 ATGGACACACACCGCCATCGTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619308 X:1443717-1443739 GTGGACACACACCCCCATCGTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619318 X:1443780-1443802 GTGGACACACACCCCCATCGTGG + Intronic
1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG + Intronic
1185619333 X:1443862-1443884 GTGGACAGACACCGCCGTCGTGG + Intronic
1185619336 X:1443881-1443903 GTGGACAGACACCCCCATCATGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619344 X:1443919-1443941 TTGGACAGACACCCCCGTCTTGG + Intronic
1185619349 X:1443938-1443960 TTGGACAGACACTGCCATGTTGG + Intronic
1185619870 X:1447270-1447292 TTCGACACACACTGCCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619879 X:1447327-1447349 TTGGATAAGCACCACCATCTTGG + Intronic
1185619884 X:1447362-1447384 TTGGACACACATGGCCATCTTGG + Intronic
1185619886 X:1447381-1447403 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619891 X:1447419-1447441 TTGGATAAGCACCACCATCTTGG + Intronic
1185619897 X:1447454-1447476 TTGGACACACACGGCCATGTTGG + Intronic
1185619899 X:1447473-1447495 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619912 X:1447546-1447568 TTGGACACACACGGCCATCTTGG + Intronic
1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619922 X:1447619-1447641 TTGGATAAGCACCACCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619930 X:1447673-1447695 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619935 X:1447708-1447730 TTGGACAAGCACTGCCATCTTGG + Intronic
1185619939 X:1447746-1447768 TTTGACACACACCACCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619945 X:1447784-1447806 TTGGATAAGCACCACCATCTTGG + Intronic
1185619948 X:1447803-1447825 TTGGACACACACAGCTATCTTGG + Intronic
1185619954 X:1447857-1447879 TGGGACACACACTGCCATCTTGG + Intronic
1185619960 X:1447895-1447917 TTGGACAAGCACCGCCATCTTGG + Intronic
1185619966 X:1447931-1447953 TTGGATACACAACACCATCTTGG + Intronic
1185619968 X:1447950-1447972 TTGGAAAAGCACCACCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185619989 X:1448096-1448118 TTGGATAAGCACCACCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185619997 X:1448150-1448172 TTGGATAAGCACCACCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620003 X:1448188-1448210 TTGGATAAGCACCACCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620010 X:1448242-1448264 TTGGATAAGCACCACCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620017 X:1448296-1448318 TTGGATAAGCACCACCATCTTGG + Intronic
1185620023 X:1448331-1448353 TGGGACACACACTGCCATCTTGG + Intronic
1185620029 X:1448369-1448391 TTGGACAAGCACCACCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185620041 X:1448441-1448463 TTGGAAAAGCACCACCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620047 X:1448495-1448517 TTGGATAAGCACCACCATCTTGG + Intronic
1185620050 X:1448514-1448536 TTGGACACATGCCGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620055 X:1448552-1448574 TTGGATAAGCACCACCATCTTGG + Intronic
1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG + Intronic
1185620063 X:1448606-1448628 TTGGATAAGCACCACCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620069 X:1448644-1448666 TTGGATAAGCACCACCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1185620076 X:1448698-1448720 TTGGAGAAGCACCACCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1185620085 X:1448752-1448774 TTGGATAAGCACCACCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG + Intronic
1185620094 X:1448809-1448831 TTGGACAAGCACTGCCATCTTGG + Intronic
1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1190217788 X:48491670-48491692 GTGTACAGACACCACAATCTAGG - Intergenic
1195579180 X:106482268-106482290 TTGCCCAGACACCTCCATCTTGG - Intergenic
1200913126 Y:8548526-8548548 TTTCACTGACACCTCCCTCTGGG + Intergenic