ID: 1185619280

View in Genome Browser
Species Human (GRCh38)
Location X:1443537-1443559
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619273_1185619280 30 Left 1185619273 X:1443484-1443506 CCGCCATCTTGGCCATCATGGAC No data
Right 1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG No data
1185619275_1185619280 18 Left 1185619275 X:1443496-1443518 CCATCATGGACACAGTGTCATTG No data
Right 1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG No data
1185619274_1185619280 27 Left 1185619274 X:1443487-1443509 CCATCTTGGCCATCATGGACACA No data
Right 1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type