ID: 1185619283 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:1443556-1443578 |
Sequence | TTGGACACACACCGCCATCA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1185619279_1185619283 | 1 | Left | 1185619279 | X:1443532-1443554 | CCATCTTGGACAGACACCTCCAT | No data | ||
Right | 1185619283 | X:1443556-1443578 | TTGGACACACACCGCCATCATGG | No data | ||||
1185619278_1185619283 | 4 | Left | 1185619278 | X:1443529-1443551 | CCGCCATCTTGGACAGACACCTC | No data | ||
Right | 1185619283 | X:1443556-1443578 | TTGGACACACACCGCCATCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1185619283 | Original CRISPR | TTGGACACACACCGCCATCA TGG | Intronic | ||