ID: 1185619283

View in Genome Browser
Species Human (GRCh38)
Location X:1443556-1443578
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 2, 1: 20, 2: 22, 3: 31, 4: 86}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619279_1185619283 1 Left 1185619279 X:1443532-1443554 CCATCTTGGACAGACACCTCCAT 0: 1
1: 3
2: 41
3: 83
4: 255
Right 1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG 0: 2
1: 20
2: 22
3: 31
4: 86
1185619278_1185619283 4 Left 1185619278 X:1443529-1443551 CCGCCATCTTGGACAGACACCTC 0: 1
1: 5
2: 21
3: 51
4: 229
Right 1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG 0: 2
1: 20
2: 22
3: 31
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902269092 1:15290219-15290241 TGGGACACACACAACCTTCAGGG + Intronic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
906054072 1:42900549-42900571 CTGAACACACACCGCCACCAGGG - Intergenic
907962425 1:59296404-59296426 TCTGACACACACACCCATCAGGG + Intergenic
909495976 1:76279163-76279185 TTGGACACACACAGCCAGGCAGG + Intronic
916526187 1:165611625-165611647 TAGCACCCACACCGCCTTCAAGG - Intergenic
921196234 1:212760383-212760405 GTGCACACACTCAGCCATCAAGG + Intronic
922963365 1:229666863-229666885 TTGGACAGACACCTGCAGCAGGG + Intergenic
1064006101 10:11700321-11700343 TTGGACACACAGAGACACCAGGG + Intergenic
1075560100 10:123461830-123461852 TAGGAAACACAGCGCTATCAAGG - Intergenic
1075762094 10:124864719-124864741 TGGGACACACACAGGCCTCAGGG - Intergenic
1087468743 11:98545380-98545402 TGGAACACACACCCCCATTAGGG + Intergenic
1089940292 11:122409531-122409553 TTTCACCCACACCCCCATCAAGG - Intergenic
1091481647 12:838554-838576 ATGGACACACACCACCATGCTGG + Intronic
1092247112 12:6869823-6869845 TTGGACAGACACAGCCCACATGG + Intronic
1094366545 12:29688912-29688934 TTGGTCACACAGGGCCACCAGGG - Intronic
1100717571 12:97322087-97322109 TAGGACACACACAGCCCTCTTGG - Intergenic
1101002663 12:100372317-100372339 TTGGACACACAGAGACACCAGGG - Intronic
1102811458 12:115827696-115827718 TGTGTCACACACCACCATCACGG + Intergenic
1103849493 12:123922760-123922782 TTGGACACACAGAGACACCAGGG - Intronic
1108355456 13:49625475-49625497 TGAGACAGGCACCGCCATCAAGG - Intergenic
1119999425 14:79285635-79285657 TTGGACACACAAAGACACCAGGG - Intronic
1121278711 14:92685312-92685334 CTGGACACACACTGGCAGCAGGG - Intronic
1123488373 15:20760954-20760976 CTGGGAACACACAGCCATCAGGG - Intergenic
1123544870 15:21330027-21330049 CTGGGAACACACAGCCATCAGGG - Intergenic
1127327127 15:57906612-57906634 TTGGAAACAGACCACCAACAGGG - Intergenic
1131556978 15:93408148-93408170 TTGGAGAGACACCGGCAACAGGG + Intergenic
1131655319 15:94451004-94451026 TTGGATACCCAACGCCAACAAGG + Intronic
1202953216 15_KI270727v1_random:57298-57320 CTGGGAACACACAGCCATCAGGG - Intergenic
1137769247 16:51003118-51003140 CTGGAAACACAACGCCACCAAGG - Intergenic
1143434496 17:6913868-6913890 TGGGATACACACCCCCACCAGGG + Intronic
1153225087 18:2893891-2893913 TGGGAGACACACAGTCATCATGG - Intronic
1154158402 18:11961202-11961224 CTGGACACACACCCACTTCAGGG - Intergenic
1158504859 18:58038195-58038217 TTGGCCACACAGCAGCATCAGGG - Intergenic
1158591390 18:58781807-58781829 TTATACACACACCACCACCAAGG - Intergenic
1161698361 19:5782621-5782643 TTGGAGACACACAGCCATCAGGG - Intergenic
1164632394 19:29770102-29770124 TTGGACCCACACAGGCACCAGGG + Intergenic
925024535 2:597292-597314 CTGGGGACACACCACCATCAAGG + Intergenic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
932314756 2:70772528-70772550 TTGGACACAAACTGGCATAAAGG + Intergenic
933131697 2:78681050-78681072 TGGGATACACACCCCCACCAGGG + Intergenic
938962215 2:136354068-136354090 TTGGACACACAGAGATATCAGGG + Intergenic
940366372 2:152852658-152852680 TGGGATACACACCCCCACCAGGG - Intergenic
940656608 2:156494712-156494734 TGGGAAAAACACCACCATCATGG + Intronic
944161128 2:196661430-196661452 TTGGACACACAGAGACACCAGGG - Intronic
948316568 2:237031882-237031904 TCACACACACACCGCCAGCAGGG + Intergenic
948388784 2:237597770-237597792 TTGGACACAGGCCTCCATCCAGG + Intronic
1174399911 20:50270368-50270390 TGGGACACCCACCGTCATCCAGG - Intergenic
1175908638 20:62394116-62394138 GTGGACACCCAGCGCCGTCAGGG - Intronic
1176267430 20:64217555-64217577 TTGGACACACACGCCCGTAACGG - Intronic
1181626218 22:24124008-24124030 TTGGAAAGAAACCGCCTTCAGGG + Intronic
1181789192 22:25250247-25250269 TTGGAGACAAATGGCCATCAAGG - Intergenic
1185175799 22:49325832-49325854 CTGGGCTCACACCGCCAGCACGG - Intergenic
954458838 3:50614590-50614612 TTGGACACACAGCTACATGAAGG + Intronic
974990763 4:69085753-69085775 TTGGACACATACCACCAACCAGG - Intronic
977303887 4:95299212-95299234 TTGGACACACAGAGACACCAGGG + Intronic
987747508 5:21995157-21995179 TGGAACACTCACCGCGATCACGG + Intronic
991767688 5:70004957-70004979 TGGAACACTCACCGCCATCACGG + Intergenic
991846922 5:70880033-70880055 TGGAACACTCACCGCCATCACGG + Intergenic
996873444 5:128216527-128216549 TTGGCCACACACAGCAATCCGGG + Intergenic
998980806 5:147699948-147699970 TAGGTCACACACCACCATGAAGG - Intronic
1002706325 5:181162801-181162823 GTGGACACACAGGGCCATCACGG + Intergenic
1003102835 6:3190378-3190400 TTGACCACACACCGCCCCCATGG - Intergenic
1010625296 6:78131248-78131270 ATGGAAACACACTGCCATGAAGG + Intergenic
1011274080 6:85611651-85611673 CTGGACACTCACTGTCATCAAGG + Intronic
1011614895 6:89188839-89188861 TTGCACACACACAGACATCCTGG - Intronic
1012914587 6:105155890-105155912 TTGGCCACACATTGCCATCATGG - Intergenic
1014660011 6:124158232-124158254 TAGGACACACAGCGACACCAGGG - Intronic
1015711469 6:136146083-136146105 TTGGTCACTCACTGCCATCAGGG + Intronic
1018264730 6:162011654-162011676 TGGAACAAACACCGCTATCAAGG - Intronic
1022842276 7:34176085-34176107 ATGGACACACATAGACATCAGGG - Intergenic
1026595036 7:71727269-71727291 CTGCACACACACCCCCACCATGG - Intergenic
1028603117 7:92624381-92624403 TTGGACACAAAGAGACATCAGGG + Intronic
1033937802 7:146609633-146609655 TTGGACAAACACCTCTACCATGG - Intronic
1043326996 8:79064597-79064619 TTGGCCACAAACCACAATCAAGG + Intergenic
1049529773 8:143148396-143148418 ATGGGCACCCACCCCCATCATGG + Intergenic
1058275551 9:103037524-103037546 TGGGATACACACCCCCACCAGGG + Intergenic
1185603323 X:1353966-1353988 TGGGACCCCCACCCCCATCATGG + Intronic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619203 X:1443017-1443039 TTGGAGAGACACCACCATCTTGG + Intronic
1185619206 X:1443036-1443058 TTGGACGCATACCACCATCGTGG + Intronic
1185619209 X:1443055-1443077 GTGGACACACACCGTCGTCGTGG + Intronic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619214 X:1443093-1443115 TGGGACACACACCGTCGTCGTGG + Intronic
1185619216 X:1443112-1443134 GTGGACACACACCGCCGTCGTGG + Intronic
1185619219 X:1443131-1443153 GTGGACACACGCCGCCATCTTGG + Intronic
1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG + Intronic
1185619225 X:1443169-1443191 GTGGACACACACCGCCATCGTGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619232 X:1443226-1443248 GTGCACACACACCGCCGTCGTGG + Intronic
1185619235 X:1443245-1443267 GTGGACACACGCCGCCGTCTTGG + Intronic
1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619256 X:1443378-1443400 ATGGACACACGCCGCCATCTTGG + Intronic
1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic
1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG + Intronic
1185619271 X:1443473-1443495 GTGGACACATGCCGCCATCTTGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG + Intronic
1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619289 X:1443594-1443616 TTGGACAGACACCGCCATCGTGG + Intronic
1185619292 X:1443613-1443635 GTGGACAGACACCGCCATCGTGG + Intronic
1185619295 X:1443632-1443654 GTGGACAGACACCGCCATCATGG + Intronic
1185619298 X:1443651-1443673 ATGGACACACACCGCCATCATGG + Intronic
1185619301 X:1443670-1443692 ATGGACACACACCGCCATCGTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619308 X:1443717-1443739 GTGGACACACACCCCCATCGTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619318 X:1443780-1443802 GTGGACACACACCCCCATCGTGG + Intronic
1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG + Intronic
1185619330 X:1443843-1443865 GAGGACACACACCACCATCGTGG + Intronic
1185619333 X:1443862-1443884 GTGGACAGACACCGCCGTCGTGG + Intronic
1185619336 X:1443881-1443903 GTGGACAGACACCCCCATCATGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619344 X:1443919-1443941 TTGGACAGACACCCCCGTCTTGG + Intronic
1185619349 X:1443938-1443960 TTGGACAGACACTGCCATGTTGG + Intronic
1185619870 X:1447270-1447292 TTCGACACACACTGCCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619884 X:1447362-1447384 TTGGACACACATGGCCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619897 X:1447454-1447476 TTGGACACACACGGCCATGTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619912 X:1447546-1447568 TTGGACACACACGGCCATCTTGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619935 X:1447708-1447730 TTGGACAAGCACTGCCATCTTGG + Intronic
1185619939 X:1447746-1447768 TTTGACACACACCACCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619948 X:1447803-1447825 TTGGACACACACAGCTATCTTGG + Intronic
1185619954 X:1447857-1447879 TGGGACACACACTGCCATCTTGG + Intronic
1185619960 X:1447895-1447917 TTGGACAAGCACCGCCATCTTGG + Intronic
1185619966 X:1447931-1447953 TTGGATACACAACACCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620023 X:1448331-1448353 TGGGACACACACTGCCATCTTGG + Intronic
1185620029 X:1448369-1448391 TTGGACAAGCACCACCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620050 X:1448514-1448536 TTGGACACATGCCGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620094 X:1448809-1448831 TTGGACAAGCACTGCCATCTTGG + Intronic
1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1197166100 X:123379319-123379341 TTGGACACACAAAACCCTCATGG - Intronic