ID: 1185619283

View in Genome Browser
Species Human (GRCh38)
Location X:1443556-1443578
Sequence TTGGACACACACCGCCATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619279_1185619283 1 Left 1185619279 X:1443532-1443554 CCATCTTGGACAGACACCTCCAT No data
Right 1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG No data
1185619278_1185619283 4 Left 1185619278 X:1443529-1443551 CCGCCATCTTGGACAGACACCTC No data
Right 1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619283 Original CRISPR TTGGACACACACCGCCATCA TGG Intronic