ID: 1185619289

View in Genome Browser
Species Human (GRCh38)
Location X:1443594-1443616
Sequence TTGGACAGACACCGCCATCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 4, 2: 25, 3: 25, 4: 68}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619285_1185619289 1 Left 1185619285 X:1443570-1443592 CCATCATGGACACACACCGCCAT 0: 5
1: 22
2: 28
3: 52
4: 249
Right 1185619289 X:1443594-1443616 TTGGACAGACACCGCCATCGTGG 0: 1
1: 4
2: 25
3: 25
4: 68
1185619284_1185619289 4 Left 1185619284 X:1443567-1443589 CCGCCATCATGGACACACACCGC 0: 5
1: 14
2: 18
3: 29
4: 207
Right 1185619289 X:1443594-1443616 TTGGACAGACACCGCCATCGTGG 0: 1
1: 4
2: 25
3: 25
4: 68
1185619282_1185619289 20 Left 1185619282 X:1443551-1443573 CCATCTTGGACACACACCGCCAT 0: 19
1: 27
2: 46
3: 99
4: 214
Right 1185619289 X:1443594-1443616 TTGGACAGACACCGCCATCGTGG 0: 1
1: 4
2: 25
3: 25
4: 68
1185619281_1185619289 23 Left 1185619281 X:1443548-1443570 CCTCCATCTTGGACACACACCGC 0: 12
1: 16
2: 28
3: 56
4: 201
Right 1185619289 X:1443594-1443616 TTGGACAGACACCGCCATCGTGG 0: 1
1: 4
2: 25
3: 25
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619289 Original CRISPR TTGGACAGACACCGCCATCG TGG Intronic
900309038 1:2024635-2024657 TTGGACAGAGCCCCCCAGCGTGG - Intronic
918512957 1:185331293-185331315 GTGGACAGACACCTGCAGCGAGG + Intergenic
922963365 1:229666863-229666885 TTGGACAGACACCTGCAGCAGGG + Intergenic
1070150589 10:73802487-73802509 TTGGACAGCCAGTGCCCTCGTGG - Exonic
1071436709 10:85654210-85654232 TTGGAGAGAAAACGCCATGGAGG - Intronic
1077842645 11:5992001-5992023 TTGGACAGACACGGTCCACGTGG - Intergenic
1084519828 11:69656358-69656380 GTGTACAGACACCCCCATTGTGG - Intronic
1084519842 11:69656399-69656421 GTGTACAGACCCCCCCATCGTGG - Intronic
1092247112 12:6869823-6869845 TTGGACAGACACAGCCCACATGG + Intronic
1108355456 13:49625475-49625497 TGAGACAGGCACCGCCATCAAGG - Intergenic
1122558147 14:102592487-102592509 TTGGACAGCCAGCGGCAGCGGGG - Intergenic
1130583953 15:85164908-85164930 TAAGACAGACACTGTCATCGTGG - Intergenic
1131556978 15:93408148-93408170 TTGGAGAGACACCGGCAACAGGG + Intergenic
1139480305 16:67226923-67226945 CTGGACAGGCCCCGCCCTCGCGG - Intronic
1142564821 17:833204-833226 TTTTACAGACAAAGCCATCGTGG + Intronic
1148496822 17:48058040-48058062 TTGGCCAGACTCCCCCATCTTGG - Intronic
1151559139 17:74861474-74861496 TGGGACAGACACCGCGAGGGAGG - Intronic
1161698361 19:5782621-5782643 TTGGAGACACACAGCCATCAGGG - Intergenic
1162351021 19:10149572-10149594 TGGGACAGACACAGTCCTCGGGG - Exonic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
933318407 2:80742337-80742359 TTGCACAAACACAGCCATGGAGG + Intergenic
944663292 2:201938918-201938940 TGGAACAGAGACCGCCATCTCGG + Intergenic
948933886 2:241150016-241150038 TTGTACAGACGCAGCCAGCGAGG + Exonic
1168765855 20:381308-381330 TTTCACAGACCCCGCCGTCGGGG + Intronic
1181626218 22:24124008-24124030 TTGGAAAGAAACCGCCTTCAGGG + Intronic
1181788170 22:25242684-25242706 TTGGACAGAAACTGCTATCTCGG - Intergenic
1183607303 22:38873042-38873064 TTCGGCAGAAACCGCCTTCGCGG + Intergenic
949307279 3:2656781-2656803 TTGAACAGATACCGACATTGGGG - Intronic
965224103 3:165965455-165965477 TTGGACAGTCACTGCAATAGAGG - Intergenic
969639232 4:8387119-8387141 TTGGACAGGAACCGCCCTCGAGG - Intronic
978972552 4:114827846-114827868 TGGGACAGCCTCTGCCATCGTGG - Exonic
997661898 5:135595403-135595425 ATGGACAGGCACCGCCAACCAGG + Intergenic
1000015228 5:157269808-157269830 TTGTACAGACAAGGCCATCCAGG - Intronic
1004454603 6:15780276-15780298 TTGGAAAGACACCATCATCCTGG - Intergenic
1005942512 6:30571401-30571423 TTGGAGAGCCAGCCCCATCGGGG + Exonic
1016011027 6:139137029-139137051 TTGCAGAGACACAGCCAACGGGG - Intronic
1051523055 9:18012152-18012174 TTGGGGAGACACTGCCATGGTGG - Intergenic
1055241347 9:74190007-74190029 TTGGATAAAAACCGCCATGGTGG + Intergenic
1061782042 9:133001908-133001930 TTGGTCAGACACTGCCCTCTGGG + Intergenic
1062393536 9:136343395-136343417 TGGGACAGGCAGGGCCATCGGGG - Intronic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619203 X:1443017-1443039 TTGGAGAGACACCACCATCTTGG + Intronic
1185619206 X:1443036-1443058 TTGGACGCATACCACCATCGTGG + Intronic
1185619209 X:1443055-1443077 GTGGACACACACCGTCGTCGTGG + Intronic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619214 X:1443093-1443115 TGGGACACACACCGTCGTCGTGG + Intronic
1185619216 X:1443112-1443134 GTGGACACACACCGCCGTCGTGG + Intronic
1185619219 X:1443131-1443153 GTGGACACACGCCGCCATCTTGG + Intronic
1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG + Intronic
1185619225 X:1443169-1443191 GTGGACACACACCGCCATCGTGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619232 X:1443226-1443248 GTGCACACACACCGCCGTCGTGG + Intronic
1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619256 X:1443378-1443400 ATGGACACACGCCGCCATCTTGG + Intronic
1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic
1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG + Intronic
1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619289 X:1443594-1443616 TTGGACAGACACCGCCATCGTGG + Intronic
1185619292 X:1443613-1443635 GTGGACAGACACCGCCATCGTGG + Intronic
1185619295 X:1443632-1443654 GTGGACAGACACCGCCATCATGG + Intronic
1185619298 X:1443651-1443673 ATGGACACACACCGCCATCATGG + Intronic
1185619301 X:1443670-1443692 ATGGACACACACCGCCATCGTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619308 X:1443717-1443739 GTGGACACACACCCCCATCGTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619318 X:1443780-1443802 GTGGACACACACCCCCATCGTGG + Intronic
1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG + Intronic
1185619330 X:1443843-1443865 GAGGACACACACCACCATCGTGG + Intronic
1185619333 X:1443862-1443884 GTGGACAGACACCGCCGTCGTGG + Intronic
1185619336 X:1443881-1443903 GTGGACAGACACCCCCATCATGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619344 X:1443919-1443941 TTGGACAGACACCCCCGTCTTGG + Intronic
1185619349 X:1443938-1443960 TTGGACAGACACTGCCATGTTGG + Intronic
1185619870 X:1447270-1447292 TTCGACACACACTGCCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619884 X:1447362-1447384 TTGGACACACATGGCCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619897 X:1447454-1447476 TTGGACACACACGGCCATGTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619912 X:1447546-1447568 TTGGACACACACGGCCATCTTGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619935 X:1447708-1447730 TTGGACAAGCACTGCCATCTTGG + Intronic
1185619939 X:1447746-1447768 TTTGACACACACCACCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619948 X:1447803-1447825 TTGGACACACACAGCTATCTTGG + Intronic
1185619954 X:1447857-1447879 TGGGACACACACTGCCATCTTGG + Intronic
1185619960 X:1447895-1447917 TTGGACAAGCACCGCCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620023 X:1448331-1448353 TGGGACACACACTGCCATCTTGG + Intronic
1185620029 X:1448369-1448391 TTGGACAAGCACCACCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620050 X:1448514-1448536 TTGGACACATGCCGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620094 X:1448809-1448831 TTGGACAAGCACTGCCATCTTGG + Intronic
1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1186913665 X:14196907-14196929 TTGCACAGACACCACTATGGAGG - Intergenic
1195579180 X:106482268-106482290 TTGCCCAGACACCTCCATCTTGG - Intergenic
1200698876 Y:6385445-6385467 TTGTACAGACAGAGCCATCCTGG + Intergenic
1201035236 Y:9779254-9779276 TTGTACAGACAGAGCCATCCTGG - Intergenic