ID: 1185619293

View in Genome Browser
Species Human (GRCh38)
Location X:1443624-1443646
Sequence GCGGTGTCTGTCCACGATGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619293_1185619301 23 Left 1185619293 X:1443624-1443646 CCGCCATCGTGGACAGACACCGC No data
Right 1185619301 X:1443670-1443692 ATGGACACACACCGCCATCGTGG No data
1185619293_1185619298 4 Left 1185619293 X:1443624-1443646 CCGCCATCGTGGACAGACACCGC No data
Right 1185619298 X:1443651-1443673 ATGGACACACACCGCCATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619293 Original CRISPR GCGGTGTCTGTCCACGATGG CGG (reversed) Intronic